Longitudinal surveillance of SARS-like coronaviruses in bats by quantitative real-time PCR

  • Mei-Niang Wang,

    Affiliation Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China

  • Wei Zhang,

    Affiliation Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China

  • Yu-Tao Gao,

    Affiliation Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China

  • Ben Hu,

    Affiliation Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China

  • Xing-Yi Ge,

    Affiliation Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China

  • Xing-Lou Yang,

    Affiliation Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China

  • Yun-Zhi Zhang,

    Affiliation Yunnan Provincial Key Laboratory for Zoonosis Control and Prevention, Yunnan Institute of Endemic Diseases Control and Prevention, Dali 671000, China

  • Zheng-Li Shi


    Affiliation Key Laboratory of Special Pathogens and Biosafety, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China


Longitudinal surveillance of SARS-like coronaviruses in bats by quantitative real-time PCR

  • Mei-Niang Wang, 
  • Wei Zhang, 
  • Yu-Tao Gao, 
  • Ben Hu, 
  • Xing-Yi Ge, 
  • Xing-Lou Yang, 
  • Yun-Zhi Zhang, 
  • Zheng-Li Shi

Dear Editor,

The 2002–2003 severe acute respiratory syndrome coronavirus(SARS-CoV)(Drosten et al., 2003)caused human p and emics that began in China and spread globally. Subsequently, diverse SARS-like coronaviruses(SL-CoVs)have been detected in horseshoe bats in China, Europe, and Africa(Li et al., 2005; Tong et al., 2009; Drexler et al., 2010). Recently, we found SL-CoVs with high genetic diversity in a single bat colony predominantly roosted by Chinese horseshoe bats(Rhinolophus sinicus)in Kunming, Yunnan province(Ge et al., 2013). Two of these SL-CoVs are able to use human ACE2 as a receptor for cell entry(Ge et al., 2013; Menachery et al., 2015), highlighting the risk of this group of viruses to humans and the importance of long-term surveillance.

We conducted a longitudinal surveillance study of bat SL-CoVs using quantitative real-time PCR(qRT-PCR)targeting the nucleocapsid(N) and RNA-dependent RNA polymerase(RdRp)genes in one bat population in Yunnan, China. A total of 431 bat fecal samples were collected during 2011–2014. Total RNA extraction was performed with 200 μL of each fecal sample using a High Pure Viral RNA Kit(Roche, Basel, Switzerl and)according to the manufacturer's instructions. Five microliters of RNA was used to screen for all alphacoronaviruses and betacoronaviruses as previously described(Ge et al., 2013). To construct st and ard templates, fragments of the N and RdRp genes were amplified from WIV1 genomic RNA and cloned into the pGEM-T Easy Plasmid Vector(Promega, Madison, USA). The primers and probe for the N gene were adopted from our previous report(Ge et al., 2013) and the primers and probe targeting the conserved region of RdRp was newly designed(Supplementary Table S1). Both forward primers contained a 5′-T7 RNA polymerase promoter sequence(TAATACGACTCACTATAGGG)to facilitate in vitro transcription. Correct clones were transcribed using the MAXIscript® Kit(Applied Biosystems, Waltham, USA). Following purification and quantification, ten-fold serial dilutions of the RNA transcripts of the N and RdRp genes were used as external st and ards to calculate viral concentrations, which are expressed as genome copies per gram of bat feces(copies/g).

The qRT-PCRs were performed using an AgPath-ID One-Step RT-PCR Kit(Applied Biosystems)according to the manufacturer's instructions. Each 25-μL reaction mixture contained 12.5 μL of 2× RT-PCR buffer, 1 μL of RT-PCR Enzyme Mix, 400 nmol/L each primer, 120 nmol/L probe primer, and 1 μL of nucleic acid extract. Amplification was carried out in 96-well plates using the StepOne PCR system(Applied Biosystems). Thermocycling conditions were as follows: 10 min at 45 ℃ for reverse transcription, 10 min at 95 ℃ for activation of the Taq DNA polymerase, and 40 cycles of 95 ℃ for 15 sec and 60 ℃ for 45 sec. Each run included three viral positive control templates and one negative control to evaluate assay performance. A positive result was defined as a well-defined exponential fluorescence curve that crossed the cycle threshold(Ct)within 38 cycles. A specimen with a Ct value > 36 was assayed again to exclude operation faults. Data were analyzed using the analysis of variance(ANOVA)for continuous variables. All comparisons were two-tailed and a P-value of less than 0.05 was considered significant.

The analytical detection range and sensitivity of the two real-time PCR assays for SL-CoVs were investigated by testing 10-fold serial dilutions of RNA transcripts and WIV1 genomic RNA. The highest dilution of transcripts at which all three replicates were positive was defined as the limit of detection(LoD). Ct values were plotted against the log10 of gene copy number, and linearity was observed over the entire virus concentration range(Supplementary Figure S1). LoD values of N and RdRp transcripts were three and four copies, respectively. Linear amplifications for the N assay ranged from 101 to 109 copies/reaction(efficiency values, 132%), while for RdRp were from 100 to 109 copies/reaction(efficiency values, 109%). The LoDs of WIV1 genomic RNA were as low as 2.04 × 10–2 plaque forming units(pfu)/reaction for both assays. Linear amplifications ranged from 2.04 × 10–2 to 2.04 × 105 pfu/reaction, with efficiency values of 85% and 84%, respectively(Supplementary Figure S2). The specificity of the two assays was then confirmed using Orthoreovirus isolated from a bat(Yang et al., 2015), and viral-containing bat fecal samples that are positive for paramyxovirus, hepatitis A virus, hepatitis B virus, hepatitis E virus, or coronaviruses other than SL-CoVs(unpublished). No false positive was observed for any of these samples(data not shown).

Fifty-seven of 431 bat fecal samples were positive for SL-CoVs by RT-PCR screening. The detection rate varied significantly among sampling dates(ANOVA, F = 28.42, P = 0.03), from 3.1% to 48.7%. The highest detection rate was observed in September 2012. St and ard curves of in vitro transcribed RNA for both assays were obtained, with R2 > 0.99(Supplementary Figure S3). qRT-PCR assays for N and RdRp were used to quantify the concentration of SL-CoVs in the positive samples. Both assays were sensitive and efficient when extracted RNAs were used as templates. Additionally, the Ct values(means of triplicates ± st and ard deviation)for most of the bat fecal samples were within 36. The virus concentrations of these specimens are listed in supplementary Table S2. Of note, the concentration of individual samples varied significantly(ANOVA, F = 4.03, P < 0.001), from 105 to 1011 copies/g bat feces in the RdRp assay or 106 to 1011 copies/g in the N assay(Figure 1A). The sample with the highest virus concentration was collected in September 2012(1.71 × 1011 copies/g for the RdRp assay and 4.58 × 1011 copies/g for the N assay. Ten samples(17%)had virus concentrations of greater than 109 copies/g, four of which were collected in September 2012 and four in July 2013. Additionally, the average of bat SL-CoVs for the seven sampling times was evaluated. As shown in Figure 1B, three significant peaks were observed(ANOVA, F = 1.5, P < 0.05). The first peak corresponding to the highest virus detection rate was observed in September 2012. The second peak was in July 2013 and the third peak was in October 2014.

Fig 1. qRT-PCR assays of SL-CoVs in bat fecal samples. (A) SL-CoV concentration in individual bat fecal samples. Circles represent the N assay, diamonds represent the RdRp assay. (B) SL-CoV concentrations for seven sampling dates.

Both assays sensitively and efficiently detected SL-CoV RNA in environmental samples. However, the virus concentrations for the RdRp assay were slightly lower than those of the N assay, normally by one order of magnitude. To assess whether the discrepancy was caused by a systematic error, repeatability was assessed by replicating the st and ard controls at least three times. The relative abundance of the subgenomic mRNA for N was higher than that of RdRp during virus replication, consistent with previous observations(Lu et al., 2014), indicating that sensitivity was higher for the N assay than the RdRp assay. Although higher virus concentrations were generally observed for the N assay compared to the RdRp assay, three samples contained less virus in the N assay(with Ct values abnormally exceeding 36). These results indicate that the N assay is more sensitive and the RdRp assay is more stable and accurate. The combination of these two assays could greatly reduce the false-positive rate in future surveillance studies of SL-CoVs.

Bats in this unique cave excreted 105 –1011 copies/g SL-CoVs from 2011 to 2014. The N and RdRp assays revealed dynamic changes in SL-CoV concentrations in the longitudinal surveillance. Fecal pellets with high virus concentrations were typically collected in either September 2012 or July 2013. Additionally, the average virus concentrations in July, September, and October were over 5-fold higher than those observed in April and May. These results indicated that SL-CoV amplification was more efficient from the late summer to autumn. Similar qRT-PCR results for other bat viruses, such as alphacoronaviruses(Drexler et al., 2011), henipaviruses(Chua et al., 2002), and filoviruses(Pourrut et al., 2007), have been reported. Bat-borne RNA viruses appear to have increased amplification and transmission efficiencies from the late summer to autumn, unlike DNA viruses(Drexler et al., 2011). Hypothetically, the higher concentrations of RNA viruses in bats at specific times may be related to the life habit of bats. Virus amplification after July may be associated with the establishment of a susceptible subpopulation of newborn bats who had not yet mounted their own adaptive immunity during the parturition period(Drexler et al., 2011). Our longitudinal survey of SL-CoVs in one bat population over 4 years provides valuable data for surveillance efforts to monitor the potential transmission of these viruses to humans.


This work was jointly funded by the National Natural Science Foundation of China(81290341), China Mega-Project for Infectious Disease(2014ZX10004001-003)from the Minister of Science and Technology of the People's Republic of China and USNIAID(R01AI110964). The authors declare that they have no conflict of interest. This article does not contain any studies with human or animal subjects performed by any of the authors.

Supplementary figures/tables are available on the website of Virologica Sinica: www.virosin.org;link.springer.com/journal/12250.

Table S1. Primer and probe sequences used in this study.
ID Target Gene Primer or Probes (5'-3') Length (bp) Assay use Reference
T-RdRp F RdRp TAATACGACTCACTATAGGGACACCGTTTCTACAGG 300 Sample quantity control this study
N R1 AAGTGAAGCTTCTGGGCCAG 80 Specimen screening (Ge et al., 2013)
Note: a: Probes were labeled at the 5′ end with the reporter molecule 6-carboxyfluorescein (6-FAM) and at the 3′ end with Black Hole Quencher 1 (BHQ1).

Fig S1. Plots of serial 10-fold dilutions for RNA transcripts analyzed by SL-CoV qRT-PCR assays. (A) N assay; (B) RdRp assay. Plot inserts show calculated linear correlation coefficients (R2 ) and amplification efficiencies for each assay.

Fig S2. Plots of serial 10-fold dilutions from 2.04 10–2 to 2.04 105 copies / reaction for RNA genome of purified WIV1 analyzed by SL-CoV qRT-PCR assays. (A) N assay; (B) RdRp assay. Plot inserts show calculated linear correlation coefficients (R2 ) and amplification efficiencies for each assay.

Fig S3. Standard curves of in vitro transcribed RNA to quantify SL-CoVs by qRT-PCR. (A) Standard curve for the N assay; (B) Standard curve for the RdRp assay.

Table S2. The SL-CoV concentration in individual bat fecal sample quantified by qRT-PCR assays.
Samples N RdRp
Ct value (Mean of triplicates ± standard deviation) Copies/g Ct value (Mean of triplicates ± standard deviation) Copies/g
201110 3267 36.02 ± 1.05 1.18E + 07 31.48 ± 0.08 3.42E + 07
3262 26.92 ± 0.21 2.20E + 09 27.30 ± 0.58 5.05E + 08
3261 25.48 ± 0.11 5.04E + 09 30.77 ± 0.45 5.39E + 07
201205 3367 30.46 ± 0.45 5.77E + 08 31.74 ± 0.17 2.89E + 07
3371 36.09 ± 0.03 2.28E + 07 32.45 ± 0.49 1.82E + 07
3375 37.09 ± 0.05 1.28E + 07 31.86 ± 0.38 2.68E + 07
201209 4089 36.38 ± 0.32 1.93E + 07 31.77 ± 0.24 2.83E + 07
4079 34.32 ± 0.78 6.30E + 07 31.66 ± 0.11 3.03E + 07
4083 32.52 ± 0.28 1.76E + 08 31.76 ± 0.44 2.85E + 07
4090 30.87 ± 0.36 4.55E + 08 30.81 ± 0.32 5.27E + 07
4103 30.22 ± 0.4 6.63E + 08 30.52 ± 0.51 6.34E + 07
4080 28.58 ± 0.03 8.51E + 08 29.75 ± 0.08 1.04E + 08
4108 29.74 ± 0.28 8.71E + 08 30.98 ± 0.3 4.71E + 07
4097 29.53 ± 0.73 9.85E + 08 29.94 ± 0.25 9.19E + 07
4085 29.24 ± 0.28 1.16E + 09 30.96 ± 0.47 4.78E + 07
4087 28.86 ± 0.24 1.45E + 09 30.80 ± 0.4 5.28E + 07
4096 26.53 ± 0.57 5.52E + 09 27.99 ± 0.09 3.24E + 08
4084 26.48 ± 0.21 5.68E + 09 30.46 ± 0.48 6.60E + 07
4122 24.64 ± 0.15 1.63E + 10 26.92 ± 0.21 6.45E + 08
4091 24.55 ± 0.07 1.71E + 10 27.09 ± 0.23 5.79E + 08
4081 23.09 ± 0.15 1.99E + 10 23.22 ± 0.35 7.06E + 09
4110 24.25 ± 0.17 2.04E + 10 27.09 ± 0.13 5.79E + 08
4105 22.18 ± 0.2 6.68E + 10 24.37 ± 0.54 3.35E + 09
4075 18.33 ± 0.03 3.05E + 11 19.20 ± 0.31 9.43E + 10
4092 17.62 ± 0.09 4.58E + 11 18.28 ± 0.52 1.71E + 11
201304 4221 33.57 ± 0.7 2.83E + 07 34.52 ± 0.34 2.81E + 06
4249 32.91 ± 0.88 8.25E + 07 31.43 ± 0.51 2.05E + 07
4258 32.25 ± 0.46 1.21E + 08 30.75 ± 3.58 3.19E + 07
4224 30.56 ± 0.18 1.59E + 08 31.67 ± 0.63 1.76E + 07
4250 30.54 ± 0.12 1.61E + 08 32.03 ± 0.66 1.40E + 07
4255 31.24 ± 0.06 2.15E + 08 31.85 ± 0.03 1.57E + 07
4246 31.17 ± 0.57 2.24E + 08 30.97 ± 0.13 2.77E + 07
4254 30.99 ± 0.55 2.48E + 08 32.72 ± 0.41 8.92E + 06
4230 30.92 ± 0.48 2.59E + 08 30.03 ± 0.32 5.07E + 07
4213 30.75 ± 0.52 2.84E + 08 29.17 ± 0.45 8.81E + 07
4256 30.24 ± 0.27 3.82E + 08 29.38 ± 0.25 7.70E + 07
4228 29.96 ± 0.24 4.49E + 08 28.55 ± 0.92 1.31E + 08
4235 28.14 ± 0.08 1.27E + 09 28.09 ± 0.79 1.78E + 08
201110 3267 36.02 ± 1.05 1.18E + 07 31.48 ± 0.08 3.42E + 07
3262 26.92 ± 0.21 2.20E + 09 27.30 ± 0.58 5.05E + 08
3261 25.48 ± 0.11 5.04E + 09 30.77 ± 0.45 5.39E + 07
201205 3367 30.46 ± 0.45 5.77E + 08 31.74 ± 0.17 2.89E + 07
3371 36.09 ± 0.03 2.28E + 07 32.45 ± 0.49 1.82E + 07
3375 37.09 ± 0.05 1.28E + 07 31.86 ± 0.38 2.68E + 07
201209 4089 36.38 ± 0.32 1.93E + 07 31.77 ± 0.24 2.83E + 07
4079 34.32 ± 0.78 6.30E + 07 31.66 ± 0.11 3.03E + 07
4083 32.52 ± 0.28 1.76E + 08 31.76 ± 0.44 2.85E + 07
4090 30.87 ± 0.36 4.55E + 08 30.81 ± 0.32 5.27E + 07
4103 30.22 ± 0.4 6.63E + 08 30.52 ± 0.51 6.34E + 07
4080 28.58 ± 0.03 8.51E + 08 29.75 ± 0.08 1.04E + 08
4108 29.74 ± 0.28 8.71E + 08 30.98 ± 0.3 4.71E + 07
4097 29.53 ± 0.73 9.85E + 08 29.94 ± 0.25 9.19E + 07
4085 29.24 ± 0.28 1.16E + 09 30.96 ± 0.47 4.78E + 07
4087 28.86 ± 0.24 1.45E + 09 30.80 ± 0.4 5.28E + 07
4096 26.53 ± 0.57 5.52E + 09 27.99 ± 0.09 3.24E + 08
4084 26.48 ± 0.21 5.68E + 09 30.46 ± 0.48 6.60E + 07
4122 24.64 ± 0.15 1.63E + 10 26.92 ± 0.21 6.45E + 08
4091 24.55 ± 0.07 1.71E + 10 27.09 ± 0.23 5.79E + 08
4081 23.09 ± 0.15 1.99E + 10 23.22 ± 0.35 7.06E + 09
4110 24.25 ± 0.17 2.04E + 10 27.09 ± 0.13 5.79E + 08
4105 22.18 ± 0.2 6.68E + 10 24.37 ± 0.54 3.35E + 09
4075 18.33 ± 0.03 3.05E + 11 19.20 ± 0.31 9.43E + 10
4092 17.62 ± 0.09 4.58E + 11 18.28 ± 0.52 1.71E + 11
201304 4221 33.57 ± 0.7 2.83E + 07 34.52 ± 0.34 2.81E + 06
4249 32.91 ± 0.88 8.25E + 07 31.43 ± 0.51 2.05E + 07
4258 32.25 ± 0.46 1.21E + 08 30.75 ± 3.58 3.19E + 07
4224 30.56 ± 0.18 1.59E + 08 31.67 ± 0.63 1.76E + 07
4250 30.54 ± 0.12 1.61E + 08 32.03 ± 0.66 1.40E + 07
4255 31.24 ± 0.06 2.15E + 08 31.85 ± 0.03 1.57E + 07
4246 31.17 ± 0.57 2.24E + 08 30.97 ± 0.13 2.77E + 07
4254 30.99 ± 0.55 2.48E + 08 32.72 ± 0.41 8.92E + 06
4230 30.92 ± 0.48 2.59E + 08 30.03 ± 0.32 5.07E + 07
4213 30.75 ± 0.52 2.84E + 08 29.17 ± 0.45 8.81E + 07
4256 30.24 ± 0.27 3.82E + 08 29.38 ± 0.25 7.70E + 07
4228 29.96 ± 0.24 4.49E + 08 28.55 ± 0.92 1.31E + 08
4235 28.14 ± 0.08 1.27E + 09 28.09 ± 0.79 1.78E + 08
4247 27.71 ± 0.33 1.63E + 09 27.37 ± 0.63 2.82E + 08
4237 27.20 ± 0.93 2.18E + 09 26.55 ± 0.06 4.80E + 08
4231 23.04 ± 0.1 1.19E + 10 23.86 ± 0.56 2.71E + 09
201307 4872 35.43 ± 0.1 9.72E + 06 37.05 ± 0.73 5.48E + 05
4937 33.95 ± 0.02 4.54E + 07 34.03 ± 1.66 3.84E + 06
4834 32.51 ± 0.07 5.19E + 07 30.69 ± 0.91 3.32E + 07
4829 28.24 ± 0.42 1.20E + 09 29.12 ± 0.59 9.15E + 07
4952 26.35 ± 0.37 3.55E + 09 25.92 ± 0.05 7.19E + 08
4832 23.79 ± 0.78 1.55E + 10 24.78 ± 0.23 1.50E + 09
4841 22.56 ± 0.03 3.13E + 10 28.31 ± 0.65 1.54E + 08
4900 22.56 ± 0.41 3.13E + 10 22.24 ± 0.28 7.70E + 09
4943 22.38 ± 0.43 3.49E + 10 21.94 ± 0.31 9.36E + 09
201405 6530 33.94 ± 0.25 2.28E + 07 36.98 ± 0.67 5.75E + 05
6526 30.87 ± 0.63 2.66E + 08 29.56 ± 0.66 6.85E + 07
6500 30.73 ± 0.39 2.88E + 08 29.77 ± 0.98 6.01E + 07
201410 7335 36.75 ± 0.33 9.10E + 06 37.52 ± 0.5 2.03E + 05
7330 33.37 ± 0.52 6.32E + 07 33.05 ± 0.65 3.61E + 06
7327 27.56 ± 0.08 1.78E + 09 29.79 ± 0.19 2.95E + 07
7326 25.49 ± 0.09 5.85E + 09 27.08 ± 0.32 1.71E + 08
7325 36.02 ± 1.05 9.40E + 08 22.95 ± 0.14 2.51E + 10


  1. . Chua KB, Koh CL, Hooi PS, et al. 2002. Microbes Infect, 4: 145.
  2. . Drexler JF, Corman VM, Wegner T, et al. 2011. Emerg Infect Dis, 17: 449.
  3. . Drexler JF, Gloza-Rausch F, Glende J, et al. 2010. J Virol, 84: 11336.
  4. . Drosten C, Gunther S, Preiser W, et al. 2003. N Engl J Med, 348: 1967.
  5. . Ge XY, Li JL, Yang XL, et al. 2013. Nature, 503: 535.
  6. . Li W, Shi Z, Yu M, et al. 2005. Science, 310: 676.
  7. . Lu XY, Whitaker B, Sakthivel SKK, et al. 2014. J Clin Microbiol, 52: 67.
  8. . Menachery VD, Yount BL Jr., Debbink K, et al. 2015. Nat Med, 21: 1508.
  9. . Pourrut X, Delicat A, Rollin PE, et al. 2007. J Infect Dis, 196.
  10. . Tang XC, Zhang JX, Zhang SY, et al. 2006. J Virol, 80: 7481.
  11. . Tong S, Conrardy C, Ruone S, et al. 2009. Emerg Infect Dis, 15: 482.
  12. . Vijaykrishna D, Smith GJD, Zhang JX, et al. 2007. J Virol, 81: 4012.
  13. . Wang LF, Shi ZL, Zhang SY, et al. 2006. Emerg Infect Dis, 12: 1834.
  14. . Yang XL, Tan B, Wang B, et al. 2015. J Gen Virol, doi: 10.1099/jgv. 0.000314..
  15. . Yuan J, Hon CC, Li Y, et al. 2010. J Gen Virol, 91: 1058.