Citation: Shu-Lin Lang, Xiao-Yan Tao, Zhen-Yang Guo, Qing Tang, Hao Li, Cui-Ping Yin, Ying Li, Guo-Dong Liang. Molecular Characterization of Viral G Gene in Emerging and Re-emerging Areas of Rabies in China, 2007 to 2011 * .VIROLOGICA SINICA, 2012, 27(3) : 194-203.  http://dx.doi.org/10.1007/s12250-012-3248-7

Molecular Characterization of Viral G Gene in Emerging and Re-emerging Areas of Rabies in China, 2007 to 2011 *

cstr: 32224.14.s12250-012-3248-7
  • Corresponding author: Qing Tang, qtang04@sina.com
  • Received Date: 27 February 2012
    Accepted Date: 23 April 2012
    Available online: 01 June 2012

    Fund Project: Pathogens Network Monitoring Technology Research 2008ZX10004-008National Department Public Benefit Research Foundation 201103032

  • In recent years (2007 to 2011), although the overall number of rabies cases in China has decreased, there is evidence of emerging or re-emerging cases in regions without previous rabies cases or with low incidence of rabies. To investigate the origin and the factors affecting the spread of rabies in China, specimens were collected from 2007 to 2011 from provinces with emerging and re-emerging cases and tested for the presence of the rabies virus. Positive specimens were combined with sequences from GenBank to perform comparisons of homology and functional sites, and to carry out phylogenetic analyses. Out of these regions, five provinces had 9 positive specimens from canine and cattle, and 34 canine or human specimens were obtained from previously high-incidence provinces. Complete sequences of G gene were obtained for these samples. Homology of the sequences of these 43 specimens was 87%-100% at the nucleotide level and 93.7% -100% at the amino acid level. These G gene sequences were combined with reference sequence from GenBank and used to construct a phylogenetic tree. The results showed that 43 specimens were all assigned to China clade I and clade II, with all specimens from emerging and re-emerging areas placed within clade I. Specimens isolated from Shanxi and Inner Mongolia in 2011 were distinct from previously-isolated local strains and had closer homology to strains from Hebei, Beijing and Tianjin whereas new isolates from Shanghai were tightly clustered with strains isolated in the 1990s. Finally, Shaanxi isolates were clustered with strains from adjacent Sichuan. Our results suggest that the rabies cases in emerging and re-emerging areas in China in the last 5 years are a consequence of the epidemic spreading from of neighboring provinces and regions experiencing a serious epidemic of rabies.

  • 加载中
    1. Badrane H, Tordo N. 2001. Host switching in Lyssavirus history from the Chiroptera to the Carniv or a orders. J Virol, 75(17): 8096-8104.
        doi: 10.1128/JVI.75.17.8096-8104.2001

    2. Gong W, Jiang Y, Za Y, et al. 2010. Temporal and spatial dynamics of rabies viruses in China and Southeast Asia. Virus Res, 150(1-2): 111-118.
        doi: 10.1016/j.virusres.2010.02.019

    3. Hall T A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program forWindows 95/98/NT. Nuc Acids Symp Ser, 41: 95-98.

    4. Hillis D M, Bull J J. 1993. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Systemat Biol, 42:182-192.
        doi: 10.1093/sysbio/42.2.182

    5. Hu R L, Tang Q, Tang J R, et al. 2009. Rabies in China: An Update. Vector-borne zoonot, 9(1):1-4.
        doi: 10.1089/vbz.2008.0046

    6. Jackson A C. 2002. Pathogenesis. In: Rabies. Jackson A C and Wunner W H, ed. London: Elsevier Science, 246-282.

    7. Lei Y L, Wang X G, Li H, et al. 2009. New animal hosts of rabies virus in mountain areas in Zhejiang province. Chin J Epedemiol, 30(4) : 344-347. (in Chinese)

    8. Li H, Shen X X, Tang Q. 2009.Analysis On epidemic characteristics of rabies in China, in 2007. Chin J Epedemiol, 30(8): 874-875. (in Chinese)

    9. Li H, Tao X Y, Song M, et al. 2008. Survey and analysis of infection rate of dog rabies in the regions with high incidence of human rabies. Chinese J Exp Chin Virol, 22(3):161-164. (in Chinese)

    10. Mellquist J T, Kasturi L, Spitalnik S L, et al. 1998. The amino acid following an Asn-X-Ser/Thr sequon is animportant determinant of N-Linked core glycosylation efficiency. Biochemistry, 37:6833-6837.
        doi: 10.1021/bi972217k

    11. Meng S, Xu G, Wu X, et al. 2010. Transmission dynamics of rabies in China over the last 40 years: 1969-2009. J Clin Virol, 49(1):47-52.
        doi: 10.1016/j.jcv.2010.06.014

    12. Nel L H, Markotter W. 2007. Lyssaviruses. Crit Rev Microbiol, 33(4):301-324.
        doi: 10.1080/10408410701647602

    13. Patricia L D, Edward C H, Florence L, et al. 2005. Phylogeography, Population Dynamics, and Molecular Evolution of European Bat Lyssaviruses. J Virol, 79:10487-10497.
        doi: 10.1128/JVI.79.16.10487-10497.2005

    14. Rustici M, Bracci L, Loci L, et al. 1993. A model of the rabies virus glycoprotein active site. Biopolymers, 33: 961-969.
        doi: 10.1002/(ISSN)1097-0282

    15. Song M, Tang Q, Wang D M, et al. 2009. Epidemiological investigations of human rabies in China. BMC Infect Dis, 9:210.
        doi: 10.1186/1471-2334-9-210

    16. Song M, Tang Q, Xu Z, et al. 2006. Analysis on the factors related to rabies, epidemic to China, in 2005. Chin J Epedemiol, 27(11):956-959. (in Chinese)

    17. Tamura K, Peterson D, Peterson N, et al. 2011. MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Mol Biol Evol, 28: 2731-2739.
        doi: 10.1093/molbev/msr121

    18. Tang Q, Lillian A O, Charles E, et al. 2000. Sequencing and Position Analysis of the Glycoprotein Gene of Four Chinese Rabies Viruses. Virol Sin, 15(1): 22-33. (in Chinese)

    19. Thompson J D, Gibson T J, Plewniak F, et al. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res, 25(24):4876-4882.
        doi: 10.1093/nar/25.24.4876

    20. WHO expert consultation on rabies: First Report. 2005. WHO technical report series #931. Geneva: World Health Organization, 1-88.

    21. Wunner W H, Reagan K J, Koprowski H. 1984. Characterization of saturable binding sites for rabies virus. J Virol, 50: 691-697.

    22. Yao W R, Pan G Q, Xiong C L, et al. 2007. Detection and genetic characterization of rabies virus from human patients. Virol Sin, 22(4):307-315.
        doi: 10.1007/s12250-007-0007-2

    23. Zhang K S, Guo J H, Xiang M, et al. 2011. Diagnosis and molecular characterization of rabies virus from a buffalo in China: a case report. Virol J, 8:101.
        doi: 10.1186/1743-422X-8-101

    24. Zhang Y Z, Xiong C L, Xiao D L. 2005. Human rabies in China. Emerg Infect Dis, 11:1983-1984.
        doi: 10.3201/eid1112.040775

    25. Zhao J, Liu Y, Zhang S, et al. 2011. Analysis of an outbreak of human rabies in 2009 in Hanzhong District, Shaanxi province, China. Vector-Borne Zoonot, 11(1): 59-68.
        doi: 10.1089/vbz.2009.0190

    26. Zhu J H, Wang J L, Cai B, et al. 1996. Immunogenicity and relative attenuation of different-rabies recombinants. Arch Virol, 141:1055-1065.
        doi: 10.1007/BF01718609

  • 加载中

Figures(4) / Tables(3)

Article Metrics

Article views(7898) PDF downloads(27) Cited by()

Related
Proportional views

    Molecular Characterization of Viral G Gene in Emerging and Re-emerging Areas of Rabies in China, 2007 to 2011 *

      Corresponding author: Qing Tang, qtang04@sina.com
    • 1. College of Animal Science, Jilin Agricultural University, Changchun 130118, China
    • 2. Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, Beijing 102206, China
    • 3. State Key Laboratory of Virology, Wuhan Institute of Virology Chinese Academy of Science, Wuhan, 430071, China
    Fund Project:  Pathogens Network Monitoring Technology Research 2008ZX10004-008National Department Public Benefit Research Foundation 201103032

    Abstract: In recent years (2007 to 2011), although the overall number of rabies cases in China has decreased, there is evidence of emerging or re-emerging cases in regions without previous rabies cases or with low incidence of rabies. To investigate the origin and the factors affecting the spread of rabies in China, specimens were collected from 2007 to 2011 from provinces with emerging and re-emerging cases and tested for the presence of the rabies virus. Positive specimens were combined with sequences from GenBank to perform comparisons of homology and functional sites, and to carry out phylogenetic analyses. Out of these regions, five provinces had 9 positive specimens from canine and cattle, and 34 canine or human specimens were obtained from previously high-incidence provinces. Complete sequences of G gene were obtained for these samples. Homology of the sequences of these 43 specimens was 87%-100% at the nucleotide level and 93.7% -100% at the amino acid level. These G gene sequences were combined with reference sequence from GenBank and used to construct a phylogenetic tree. The results showed that 43 specimens were all assigned to China clade I and clade II, with all specimens from emerging and re-emerging areas placed within clade I. Specimens isolated from Shanxi and Inner Mongolia in 2011 were distinct from previously-isolated local strains and had closer homology to strains from Hebei, Beijing and Tianjin whereas new isolates from Shanghai were tightly clustered with strains isolated in the 1990s. Finally, Shaanxi isolates were clustered with strains from adjacent Sichuan. Our results suggest that the rabies cases in emerging and re-emerging areas in China in the last 5 years are a consequence of the epidemic spreading from of neighboring provinces and regions experiencing a serious epidemic of rabies.

    • Rabies is a zoonotic infectious disease caused by rabies virus and its mortality rate is nearly 100% when infected [6]. Rabies is widely distributed across the globe. More than 55, 000 people die of rabies each year [12]. About 95% of human deaths occur in Asia and Africa. India is the most severely affected, and China is the next.Since 1996 human rabies cases in China have risen continuously until it has become one of the countries experiencing the largest number of cases. Since 2007, although the number of human cases in China has declined overall [8], some provinces and regions have continued to experience a rise and recently some regions have even seen a re-emergence in number of cases. Thus, rabies prevention and control in China continues to be a matter of great importance [8, 24].

      Rabies virus is a negative single-strand RNA virus, belonging to genus Lyssavirus, family Rhabdoviridae [12]. The overall length of viral genome is about 12 kb, and genes from 3' to 5' terminal include N(Nucleoprotein), P(Phosphoprotein), M(Matrix protein), G(Glycoprotein) and L(RNA-dependent RNA polymerase) [18]. Of these, the G gene-encoding the glycoprotein is located on the viral envelope surface, and it can effectively stimulate virus neutralizing antibodies [6]. In addition, G is the binding site of virus and host cell receptors, determining viral tissue tropism and is related to viral virulence and pathogenicity [21]. Thus, the G protein is a good choice for examining the relationship between different viral isolates.

      As part of a national surveillance program of the rabies epidemic from 2007 to 2011, this study collected rabies specimens in emerging and re-emerging areas and carried out G gene sequencing of positive samples. In order to investigate the epidemic spread of rabies in China we carried out analyses of the molecular characteristics of these sequences combined with sequences from high-incidence provinces which have seen a reduction in their epidemic situations in the last five years. Our findings provide data that should contribute towards determining rabies prevention and control strategies in the future.

    • Epidemic information was obtained from the "China information system for disease control and surveillance" program of the China CDC. Excel2007 was used for statistical analysis, and MapInfo7.0 software was used to draw the geographical distribution of national rabies cases.

    • On the basis of the national and provincial rabies epidemiology analysis from 2007 to 2011, the ranges of emerging and re-emerging areas of rabies in recent five years were determined. Rabies specimens were collected in these regions, screened for the presence of the rabies virus and combined with specimens previously collected from high-incidence provinces.

    • For brain tissue specimens direct immunofluores cence assay (DFA) was used for detection [9]. For saliva and cerebrospinal fluid specimens from rabies cases, after RNA was extracted with a QIAamp Viral RNA Mini Kit (QIAGEN company), they were reverse transcribed into cDNA with a Ready-To-Go You-Prime First-Strand Beads Kit (GE Healthcare company), and nested-PCR was used for detection [8].

      For positive brain tissue specimens as determined by DFA assay, after Trizol reagent (Invitrogen) was used to extract total RNA, cDNA was obtained by reverse transcription. RNA and cDNA of positive saliva or cerebrospinal fluid specimens were jointly used to carry out amplification and determination of G gene sequences. The following two pairs of primers were used for G gene amplification G-20F (5′-CTCAA AAGACTCAAGGAAAGATG-3′, 3298-3320), G966R (5′-ATGACTAAGACGTCTGAAACTCAC-3′, 4260-4283) and G822F-(5-′TCAGCTAGTAAATCTACATG ACTTTC-3′, 4139-4164), GR-85-(5′-GAGGACTGT TAAATCCAGAGATG-3′, -4955-4977). Primer sites corresponded to the complete genome sequence of rabies virus PV strain (M13215). The cycling parameters were one cycle at 94 ℃ for 3 min for an initial denaturation, then 35 cycles at 94 ℃ for 30 s, 30 s for 52 ℃, 70 s for 72 ℃, and a flnal extension at 72 ℃ for 10 min [18]. PCR amplification products were sent to the Beijing Biomed Company for bidirectional sequencing. Sequencing primers were identical to the amplification primers.

    • ATGC soft (Genetyx Co., Tokyo, Japan) was used for joining and calibration of sequencing segments; Clustal X v2.1 software was used to complete the sequence alignment [19]; BioEdit v7.0.4 software [3] was used to uniformly shear nucleotide sequences into the coding region and translation into amino acids; the MegAlign software in the DNAstar (5.01 version, Laser gene, USA) package was used for homology analysis for both the nucleotide and amino acids; The Neighbor-Joining (NJ) method in the MEGA4 software package [17] was used to construct a phylogenetic tree and 1000 bootstrap(BP) replicates were used to estimate the reliability of the tree. A phylogenetic tree was constructed with the whole gene sequence data, BP values > 70% were shown in the tree and taken to represent significant support for a clade [4].

    • Investigation of the geographical distribution of rabies cases in recent years (Fig. 1) shows that most cases occurred in southeast regions of China (Fig. 2). After 2007, the epidemic situation in the southeast and the overall number of cases at the national peaked and subsequently reduced year by year [24]. However, this reduction was accompanied by the emergence of cases in regions that were previously free of rabies and re-emergence in regions that previously had a low incidence of rabies cases. Specifically, new rabies cases were recorded in Shaanxi(XiAn) province, Gansu province, Liaoning province, Ningxia Autonomous Region, Xinjiang Autonomous Region (Table 1) and in six other low-incidence provinces and municipalities (Beijing, Shanxi, Inner Mongolia, Shanghai, Yunnan and Hainan) the number of cases were significantly reduced (Fig. 3).

      Figure 1.  Geographical distribution of human rabies cases in China from 2005 to 2010. Geographical expansion is shown by changes of dots.

      Figure 2.  The rabies epidemic status of each province in China, 2007-2011. Epidemic regions of different kind are marked by responding color.

      Table 1.  Rabies cases in five emerging provinces in China from 2007 to 2011

      Figure 3.  Reported rabies cases in six low-incidence provinces or municipalities from 2007 to 2011.

      Experimental testing identified 43 specimens positive for rabies virus. Of these newly collected samples, 9 samples are from emerging and reemerging regions (Shaanxi-XiAn, Shanxi, Ningxia, Inner Mongolia and Shanghai) and the rest are from epidemic regions. For these 43 positive specimens, an overall length of 1575bp for the G gene coding region was obtained. Specific background information of the specimens is shown in Table 2.

      Table 2.  Background information of 43 positive specimens obtained in this study

    • The homology of G gene nucleotide sequence of 43 specimens obtained in this study was 87% to 100%, and the amino acid sequence homology deduced from the nucleotide was 93.7%-100%. The nucleotide sequence variation was mainly composed of synonymous mutations and the G gene nucleotide sequences of some specimens from the same province were completely consistent.

      The G gene of the rabies virus encodes 524 amino acids of which the first 19 amino acids corresponds to a hydrophobic signal peptide. During transcription the signal peptide is removed and the mature glycoprotein composed of 505 amino acids is formed. The Glycoprotein is a crucial protein of the rabies virus in that it stimulates the generation of virus neutralizing antibodies [2] and there are at least three neutralizing antigenic sites (GI, GII and GIII). G II is a typical spatially-configured antigenic site located in an amino acid segment spanning sites 34 to 200. Within this region, two main epitopes are located at sites 34 to 42 and sites 198 to 200 [18]. Other important sites causing antigenic changes include site 147 and site 184; GIII is located in an amino acid segment extending from sites 330 to 357 and is a spatially-dependent antigenic site. Within this segment, sites 333 to 340 are the main binding sites of neutralizing antibodies. Also, amino acids at sites 333, 336 and 339 appear to be the key amino acids [18]. For most street strains, the amino acid at site 333 is Arg (R) which is possibly related to the virulence of virus; in the G protein of all the 43 specimens obtained in this study, R was present at this site. Compared with domestic and international isolates, all amino acids of G protein amino acid sequences of 31 virus specimens (including all the cases from emerging and re-emerging provinces) the amino acids at sites 90, 168 and 332 varied (Table 3). In particular, the hydrophobic amino acid Tyr(Y) at site 168 was replaced by hydrophilic amino acid Cys(C). These sites might be associated with the pathogenicity of rabies virus.

      Table 3.  Comparisons of amino acids sequences in the GII and GIII segments of the rabies virus G gene

      Previous results have shown that the acetylcholine (AchR) receptor acts as the cell receptor of rabies virus in vivo and that the amino acids of the glycoprotein at sites 189 to 214 are related to virus / nerve cell tropism [25]. Rustici et al. [14]proved that within the spatial structure of the glycoprotein the amino acids segment from 194-197(Asn-Ser-Arg-Gly) was important, with the spatial configuration of Asn(site 194) and Arg(site 196) residues consistent with the AchR configuration [13]. For the 31 G gene sequences (including all cases from emerging and re-emerging provinces) obtained in this study, only the amino acid at site 204 varied, whence Ser(S) was replaced by Gly(G). This indicates that rabies virus nerve cell tropism did not change significantly.

      The glycosylation signal of the G protein is the Asn-X-Thr or Asn-X-Ser motif [10]. At present, additional potential glycosylation sites include amino acids are predicted to be located at sites 37, 70, 247, 319, 465 and 480. In this study, the obtained virus specimens only had two potential glycosylation sites at sites 37 and 319.

    • The phylogenetic analysis of the G gene sequences of 43 positive specimens, as well as representative sequences of Chinese epidemic strains [11] [16] [16], and one American strain as the outgroup were downloaded from GenBank, aligned and phylogenetic analysis was carried out (Fig. 2). According to the G gene grouping of strains from the current epidemic [11], the China strains can be divided into 6 groupst (clade Ⅰ-Ⅵ) [11], and the phylogenetic tree showed that the 43 specimens were assigned to clades Ⅰ and Ⅱ with all specimens from emerging and re-emerging provinces located in clade IA.

      From 2007 to 2011, cases were recorded in five provinces and autonomous regions (Shaanxi, Gansu, Ningxia, Xinjiang and Liaoning) that were previously rabies free (Table 1), and which have been classified as re-emerging areas of rabies. No virus specimens were obtained from Gansu, Liaoning provinces and Xinjiang Autonomous Region. Four canine specimens (there were 3 specimens in this study, and 1 specimen was a previously obtained sample) provided by Shaanxi(XiAn) in 2009 were from Hanzhong, and their homology was very close, belonging to the Clade IA subgroup. Also, they had close homology with Sichuan specimens (Fig. 4). Onhuman specimen isolated in Ningxia in 2011 had the closest homology with strains from Tianjin and Beijing, whereas two other human specimens from Ningxia that were isolated in 1985 and 1986 were assigned to a different group (clade Ⅴ).

      Figure 4.  Phylogenetic tree of rabies street virus G gene sequences isolated in China. Based on a 1575nt (nt1–nt1575) glycoprotein (G) gene of rabies virus rooted with the Pasteur strain of rabies virus (PV). Numbers at each node indicate degree of bootstrap support; only those with support > 70% are indicated. New collected sequences are shown in red, sequences from GenBank are shown in black. Provinces, hosts, year of sample collection, and GenBank accession no. are included for each taxa.

      The tree showed a number of interesting associations (Fig. 4). (ⅰ) Only one Beijing sample BeijingHu1 has been released at present and this was assigned to the clade IA subgroup, and it had the closest homology to the Tianjin strain; (ⅱ) The human specimen from Shanxi and human specimens of Hebei in 2011 also formed a branch within the clade IA subgroup; (ⅲ) Canine samples from Shanxi (a low incidence region) collected in 2007 and in 2008 and samples from Hunan (high-incidence region) were all assigned to the clade IC subgroup; (ⅳ) High homology existed between the canine and milk cow specimens from Inner Mongolia in 2011, which was consistent with the infection of the cow by a dog bite; they had high homology with Hebei samples, but greater differences with local wildlife samples collected from raccoon dog in 2007 (clade IA); (Ⅴ) Samples from Shanghai had a wide range of collection dates spanning 15 years (from 1992 to 2006) but were all placed within clade IA; (ⅵ) The three samples from Yunnan showed significant diversity, and two were closer to a Guangxi strain and an Anhui strain in the clade IC subgroup, yet another was in clade Ⅵ and similar to another Guangxi strain.

    • Rabies is an ancient infectious disease, and it has more than two thousand years of epidemic history in China [5, 22]. Although rabies has continuously been present in China, the epidemic situation has varied greatly. Most recently, after serious epidemics in the 1970s and 1980s, rabies in China was effectively controlled until the mid 1990s (159 cases) [24]. Subsequently, the number of cases has increased, especially in southern provinces such as Hunan, Guangxi and Guizhou which reported annual cases of five or six hundred. National cases reached a peak of 3302 cases in 2007 and subsequently began to decrease with 1918 cases reported in 2011 [15, 16].

      Although the number of cases decreased nationally from 2007 to 2011, the geographic distribution of the epidemic has expanded. In previously high-incidence provinces, cases were significantly reduced but some provinces, such as western Shaanxi(XiAn), Gansu, Ningxia and Xinjiang and northeastern Liaoning, that had not witnessed rabies in recent years, began to experience their first cases, suggesting that current epidemic is spreading to the west and north. From 1996 to 2008, Shaanxi(XiAn) was a low-incidence region as in 13 years only 22 cases were reported and even in 2007 and 2008 there were no recorded cases; in 2009 however, 26 cases were reported. According to our phylogenetic analysis, the canine brain tissue specimens collected from Hanzhong, Shaanxi in 2009 were highly homologous and were closely related to samples collected from Sichuan (Fig. 2 and 4). The southern border of Shaanxi(XiAn) is adjacent to Sichuan and although mountains and rivers act as a natural barrier, they are well connected by commercial traffic flow which is likely to facilitate the spread of the virus. In Ningxia, there was no reported rabies incidences from 2003 to 2010 but the first cases began to appear in 2011 (2 cases, Table 1).The specimen obtained from one case in 2011(Fig. 4) was markedly divergent from specimens obtained from patients in Ningxia more than 20 years ago (clade Ⅴ), and was more homologous with recent epidemic strains obtained from Tianjin and Beijing (clade IA). Both of these results suggest that the virus is spreading from high to low incident regions; however, as virus specimens from the low incidence regions are still relatively few and have yet to be collected in Gansu, Xinjiang and Liaoning provinces, it is not yet possible to carry out a detailed epidemiological analysis.

      In summary, we have attempted to investigate the changing dynamics of the rabies epidemic in China in the last five years. While the epidemic appears to have been brought under control in high-incidence provinces, many original low-incidence provinces have experienced an increase in the number of cases. We have obtained a number of isolates from these re-emerging provinces and in this study we have examined their relationship to isolates from high incidence provinces. Our phylogenetic results indicate that these high incidence provinces appear to be 'feeding' adjacent low incidence provinces by spillover. This may well be facilitated by the reduced awareness in provinces which have not experienced rabies cases for several years and therefore are unprepared to counter the risks associated with the disease and fail to take appropriate preventative measures. It is hoped our findings will help towards determining a program for further controlling and working towards eliminating rabies in China.

    Figure (4)  Table (3) Reference (26) Relative (20)

    目录

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return