-
-
-
-
-
-
Primer Sequence 5'-3' Positions Amplicon size (bp) F1 AGCCTTTTGCGGTGACGATAGT 4490-4511 242 R1 ACTCCTCCAAGTGTTCCCAATC 4710-4731 F2 GCATCGCATCTGTTCAAGGGAC 405-426 271 R2 GTAGCGCAATGGCGTACACTCT 654-675 F3 TGTGTCGGTGTGTATTGTTT 5379-5398 204 R3 CTACTATTTTTTCCCTTTGCG 5563-5582 F4 TAAAGCACAACCCAAGCAA 3977-3995 117 R4 TCACTAAACAACGGGCAAA 4074-4093 Table 1. Primers sequences for detecting TMV
-
Centrifugal Force (g) PEG6000 concentration (%) 1 10 20 30 3000 0.70%a
(0.05%)b13.10%
(0.05%)11.63%
(0.06%)8.89%
(0.08%)4000 4.07%
(0.05%)16.66%
(0.05%)21.02%
(0.06%)17.50%
(0.08%)5000 8.66%
(0.12%)24.34%
(0.20%)50.36%
(0.16%)38.52%
(0.05%)6000 9.89%
(0.03%)44.79%
(0.11%)90.95%
(0.16%)62.02%
(0.05%)7000 8.68%
(0.26%)32.82%
(0.22%)41.88%
(0.13%)11.40%
(0.12%)Orthogonal design tests were carried out at room temperature, and the pH of standard water was ~7.2.aWithin columns indicates recovery efficiency, calculated according to the equation E (%) = (viral copy of recovered TMV/viral copy of initial seeded TMV) ×100; bwithin columns signifies standard error. Table 2. Orthogonal design tests for method optimization
-
Sample Real-time PCR RT-PCR ELISA Location Number Positive sample Positive sample Positive sample Long County 8 5 4 1 Xunyang County 9 7 5 2 Fu County 6 3 2 1 Nanzheng County 5 2 1 1 Total 28 17 12 5 Table 3. Clinical detection results with real-time PCR, RT-PCR and ELISA
Figure 5 个
Table 3 个