-
-
-
-
Case A Case B Case C Personal information Age and gender 52, female 59, male 67, male Occupation Farmer Farmer Farmer Admission day May 13, 2015 (the 4th day after illness onset) June 21, 2015 (the 5th day after illness onset) April 7, 2016 (the 5th day after illness onset) Location Macheng Guangshui Macheng Outcome Survived Fatal Survived Clinical manifestation on admission Fever Headache Fatigue Myalgia Yes♮ Yes Yes Yes Yes (38 ℃) Yes Yes Yes Yes (39.5 ℃) Yes Yes Yes Gastrointestinal symptoms Diarrhea Diarrhea Abdominal pain Nausea Vomiting Diarrhea Abdominal pain Respirotory symptoms Rales in lung Rales in lung Dyspnea Rales in lung Neurologic symptoms Headache Headache Blurred mind Limb tremor Headache Blurred mind Blood counts WBC (× 109/L) 3.37↓ 1.97↓ 2.16↓ PLT (× 109/L) 40↓ 16↓ 21↓ Urine routine test Proteinuria +++ ++ +++ Hematuria +++ +++ +++ Serum biochemistry ALT (U/L) 75↑ 91↑ 78↑ AST (U/L) 353↑ 291↑ 291↑ LDH (U/L) 4309↑ 4602↑ 192 CK (U/L) 1502↑ 1096↑ 666↑ CK-MB (U/L) 9.5 3.7 0.9 Laboratory tests qRT-PCR (TCID50/mL) 9.74 × 104 3.41 × 105 4.99 × 105 Virus isolation HBMC16 HBGS13 HBMC5 Note: WBC, white blood cells; PLT, platelet count; ALT, alanine aminotransferase; AST, aspartate aminotransferase; CK, creatine kinase; LDH, lactate dehydrogenase. CK-MB, creatine kinase isoenzyme. aThe accurate body temperature of the patient is uncertain. Clinical parameters out of the normal range are shown in bold numbers with up or down arrows. Table 1. Personal information, clinical features, and laboratory tests for SFTS patients
-
Primers Sequences (5'-3') Locations of primers S segment S1F acacaaagacccccttcatttrg 1-23 S1R ACACAAAGAACCCCCAAAAAAGGA 1722-1744 M segment M1F acacaragacggccaacaatga 1-22 M1R TCTCCCAGTTGTGAYGCATTCCTTC 1767-1791 M2F GGCAACCAWGATGATGTTAGGAT 1597-1619 M2R ACACAAAGACCGGCCAACACT 3358-3378 L segment L1 F acacaragacgcccagatgrac 1-22 L1 R GAGACCACTGRACCACATTRCTG 1549-1571 L2F GTGTCAATCTTGTTGGAAAARGCAT 1463-1487 L2R GAGCTTYGAGACGAAATARGAC 3313-3314 L3F GGTTGAAGTCAGCCCGYAGTCT 2913-2934 L3R ATTCTRACTACTTGGCTTATGGTGG 4800-4824 L4-F TTAGGGAGAGAAACATTGTCAGGAG 4485-4509 L4-R acacaaagaccgcccagatctta 6346-6368 Table S1. Primers used to sequence the complete genome of SFTSV isolates
Figure 3 个
Table 2 个