Figure 1个  Table 5个
    • Codes IBV isolates Breed history reported Major clinical signs IBV vaccination Lineage GenBank accession numbers
      1 Moroccan-G/83 Broiler Enteric N/A GI-13 EU914938
      2 IBV/Morocco/97/1986 Broiler Respiratory Unvaccinated GI-13 KM594213
      3 IBV/Morocco/91/1986 Broiler Respiratory Unvaccinated GI-13 KM594210
      4 IBV/Morocco/17/1988 Broiler N/A N/A GI-13 KM594212
      5 IBV/Morocco/11/1989 Broiler N/A N/A GI-13 KM594192
      6 IBV/Morocco/86/1996 Broiler Respiratory Vaccinated GI-1 KM594211
      7 IBV/Morocco/88/1997 Broiler Nephritis N/A GI-13 KM594202
      8 IBV/Morocco/81/1998 Broiler Nephritis N/A GI-13 KM594208
      9 IBV/Morocco/85/1998 Layers Respiratory Vaccinated GI-1 KM594209
      10 IBV/Morocco/90/2000 Broiler Nephritis Vaccinated GI-13 KM594198
      11 IBV/Morocco/92/2000 Broiler Nephritis Unvaccinated GI-13 KM594200
      12 IBV/Morocco/93/2001 Broiler Nephritis N/A GI-13 KM594194
      13 IBV/Morocco/19/2006 Broiler Nephritis Vaccinated GI-13 KM594191
      14 IBV/Morocco/05/2010 Broiler Respiratory Vaccinated GI-1 KM594218
      15 IBV/Morocco/06/2010 Broiler Respiratory Vaccinated GI-21 KM594219
      16 IBV/Morocco/31/2010 Broiler Respiratory vaccinated GI-21 KM594205
      17 IBV/Morocco/39/2010 Layer Respiratory vaccinated GI-1 KM594240
      18 IBV/Morocco/13/2011 Broiler Nephritis Unvaccinated GI-21 KM594203
      19 IBV/Morocco/18/2011 Broiler Respiratory vaccinated GI-1 KM594226
      20 IBV/Morocco/29/2011 Broiler Respiratory vaccinated GI-1 KM594232
      21 IBV/Morocco/32/2011 Broiler Nephritis vaccinated GI-13 KM594234
      22 IBV/Morocco /33/2011 Broiler Nephritis vaccinated GI-21 KM594190
      23 IBV/Morocco/34/2011 Breeder Respiratory vaccinated GI-1 KM594235
      24 IBV/Morocco/38/2011 Layer Respiratory vaccinated GI-1 KM594239
      25 IBV/Morocco/50/2011 Broiler Respiratory vaccinated GI-1 KM594249
      26 IBV/Morocco/22/2012 Broiler Respiratory vaccinated GI-1 KM594227
      27 IBV/Morocco/14/2012 Broiler Nephritis Unvaccinated GI-21 KM594195
      28 IBV/Morocco/24/2012 Broiler Nephritis Unvaccinated GI-21 KM594196
      29 IBV/Morocco/27/2012 Broiler Respiratory vaccinated GI-21 KM594199
      30 IBV/Morocco/15/2012 Broiler Respiratory Unvaccinated GI-21 KM594201
      31 IBV/Morocco/09/2012 Layer Respiratory vaccinated GI-21 KM594206
      32 IBV/Morocco/19/2012 Broiler Respiratory vaccinated GI-1 KM594214
      33 IBV/Morocco/04/2012 Broiler Respiratory vaccinated GI-1 KM594217
      34 IBV/Morocco/07/2012 Broiler Respiratory vaccinated GI-1 KM594220
      35 IBV/Morocco/08/2012 Broiler Nephritis vaccinated GI-1 KM594221
      36 IBV/Morocco/11/2012 Layer Respiratory vaccinated GI-1 KM594223
      37 IBV/Morocco/26/2012 Broiler Respiratory vaccinated GI-1 KM594230
      38 IBV/Morocco/28/2012 Broiler Respiratory vaccinated GI-1 KM594231
      39 IBV/Morocco/35/2012 Broiler Respiratory vaccinated GI-1 KM594236
      40 IBV/Morocco/36/2012 Layer Respiratory vaccinated GI-1 KM594237
      41 IBV/Morocco/37/2012 Broiler Respiratory vaccinated GI-1 KM594238
      42 IBV/Morocco/40/2012 Broiler Respiratory vaccinated GI-1 KM594241
      43 IBV/Morocco/41/2012 Broiler Respiratory vaccinated GI-1 KM594242
      44 IBV/Morocco/21/2013 Broiler Respiratory Unvaccinated GI-21 KM594193
      45 IBV/Morocco/16/2013 Broiler Respiratory vaccinated GI-21 KM594204
      46 IBV/Morocco/20/2013 Broiler Nephritis vaccinated GI-21 KM594207
      47 IBV/Morocco/03/2013 Broiler Respiratory vaccinated GI-1 KM594216
      48 IBV/Morocco/10/2013 Broiler Respiratory vaccinated GI-1 KM594222
      49 IBV/Morocco/12/2013 Broiler Respiratory vaccinated GI-1 KM594224
      50 IBV/Morocco/17/2013 Broiler Respiratory Unvaccinated GI-1 KM594225
      51 IBV/Morocco/23/2013 Broiler Respiratory vaccinated GI-1 KM594228
      52 IBV/Morocco/25/2013 Broiler Respiratory vaccinated GI-1 KM594229
      53 IBV/Morocco/30/2013 Broiler Respiratory vaccinated GI-1 KM594233
      54 IBV/Morocco/43/2013 Broiler Respiratory Unvaccinated GI-1 KM594244
      55 IBV/Morocco/46/2013 Broiler Respiratory Unvaccinated GI-21 KM594245
      56 IBV/Morocco/47/2013 Broiler Respiratory Unvaccinated GI-1 KM594246
      57 IBV/Morocco/48/2013 Broiler Respiratory Unvaccinated GI-21 KM594247
      58 IBV/Morocco/49/2013 Broiler Respiratory vaccinated GI-1 KM594248
      59 IBV/Morocco/02/2014 Broiler Respiratory vaccinated GI-1 KM594215
      60 IBV/Morocco/98/2014 Broiler Nephritis vaccinated GI-13 KM594197
      61 IBV/Morocco/42/2014 Broiler Respiratory vaccinated GI-1 KM594243
      62 IBV/Morocco/44/2014 Broiler Respiratory vaccinated GI-21 KM594188
      62 IBV/Morocco/45/2014 Broiler Nephritis vaccinated GI-1 KM594189
      Note: The last four digits of the sequence title represent the year of detection. GI, genotype I; IBV, infectious bronchitis virus; N/A, data not available.

      Table S1.  Data from 62 Moroccan IBV isolates included in this study

    • Primer name Primer sequence (5′–3′)
      Forward SX1+ CACCTAGAGGTTTGYTWGCAT
      Reverse SX2- TCCACCTCTATAAACACCYTT
      Forward SX3+ TAATACTGGYAATTTTTCAGA
      Reverse SX4- AATACAGATTGCTTACAACCACC

      Table S2.  Primers used in this study

    • Genotype Amino acid evolutionary distance
      1 2 3 4 5 6 7 8 9 10 11
      1. GI-13 – 0.236 0.254 0.498 0.219 0.228 0.145 0.245 0.228 0.221 0.176
      2. GI-9 0.170 0.227 0.483 0.220 0.194 0.208 0.257 0.231 0.262 0.257
      3. GI-1 0.174 0.146 0.449 0.182 0.234 0.230 0.264 0.229 0.239 0.198
      4. GII-1 0.356 0.349 0.318 0.481 0.491 0.469 0.483 0.501 0.468 0.496
      5. GI-12 0.162 0.169 0.113 0.352 0.232 0.195 0.189 0.215 0.226 0.243
      6. GI-3 0.169 0.129 0.137 0.364 0.165 0.205 0.269 0.242 0.269 0.248
      7. GI-21 0.106 0.159 0.166 0.339 0.153 0.154 0.234 0.202 0.203 0.181
      8. GI-26 0.173 0.181 0.176 0.349 0.150 0.183 0.169 0.266 0.227 0.266
      9. GI-16 0.167 0.184 0.163 0.373 0.167 0.180 0.161 0.203 0.250 0.254
      10. GI-19 0.171 0.197 0.157 0.365 0.177 0.201 0.158 0.179 0.193 0.267
      11. GI-24 0.094 0.192 0.142 0.362 0.177 0178 0.126 0.192 0.185 0.188 –
      Nucleotide evolutionary distance
      Note: Shown are the base substitutions per site (evolutionary distance) from averaging over all sequence pairs between genetic groups. Analyses were conducted using the Maximum Composite Likelihood model. The rate variation among sites was modeled with a gamma distribution (shape parameter = 1). All positions containing gaps and missing data were eliminated.

      Table S3.  Estimates of evolutionary distances over sequence pairs between genotypes

    • Genotype Amino acid evolutionary distance
      1 2 3 4 5
      Cluster 1 – 0.066 0.052 0.096 0.076
      Cluster 2 0.051 0.068 0.116 0.090
      Cluster 3 0.030 0.041 0.098 0.072
      Cluster 4 0.063 0.084 0.060 0.089
      GI-13 reference strains 0.050 0.066 0.044 0.056 –
      Nucleotide evolutionary distance
      Note: Shown are the base substitutions per site (evolutionary distance) from averaging over all sequence pairs between groups. Standard error estimate(s) are shown above the diagonal, in italic font. Analyses were conducted using the Maximum Composite Likelihood model. The rate variation among sites was modeled with a gamma distribution (shape parameter = 1). All positions containing gaps and missing data were eliminated.

      Table S4.  Estimates of evolutionary distances over sequence pairs between Moroccan lineage GI-13 isolates

    • Strain Deletions or substitutions Insertions
      268 271 285 287 289 293 296 297 299 301 306 326 329 338 340 345 364 291 351
      GI-13 prototypea E I V N A S V D F Q H K D K N N I – –
      IBV/93/2001 E V V N A S V D F Q R K D P N N L – –
      IBV/19/2006 E V V N A S V D F Q R K D P N N L – –
      MoroccanG/83 E T V N S S V D F Q H I D E T T I – –
      IBV/11/1989 E T V N S S V D F Q H I D E T T I – –
      IBV/17/2013 E T V N S S V D F Q H I D E T T I – –
      IBV/98/2014 E T V N S S V D F Q H K D N N N I – –
      IBV/32/2011 E I V N A S V D F Q H K D K N N I – –
      IBV/81/1998 E I V N V L I E L V H K N P N N I – –
      IBV/90/2000 E I V N V L I E L V H K N P N N I – –
      IBV/88/1997 E I V N V L I E L V H K N P N N I – –
      IBV/91/1986 E I V N V L I E L V H K N P N N I – –
      IBV/92/2000 E I V N V L I E L V H K N P N N I – –
      IBV/97/1986 E I V N V L I E L V H K N P N N I – –
      GI-21 prototypeb E V E N P S V N F V H K D K N N I – –
      IBV/31/2010 E V V D P S V N F V H K D T N N I L W
      IBV/13/2011 E V V D P S V N F V H K D T N N I L W
      IBV/33/2011 E V V D P S V N F V H K D T N N I L W
      IBV/14/2012 E V V D P S V N F V H K D T N N I L W
      IBV/24/2012 E V V D P S V N F V H K D T N N I L W
      IBV/27/2012 E V V D P S V N F V H K D T N N I L W
      IBV/09/2012 E V V D P S V N F V H K D T N N I L W
      IBV/21/2013 E V V D P S V N F V H K D T N N I L W
      IBV/16/2013 E V V D P S V N F V H K D T N N I L W
      IBV/20/2013 E V V D P S V N F V H K D T N N I L W
      IBV/44/2014 E V V D P S V N F V H K D T N N I L W
      IBV/46/2013 E V V D P S V N F V H K D T N N I L W
      IBV/06/2010 E V V D P S V N F V H K D T N N I L W
      IBV/15/2012 E V E N P S V N F V H K D K N N I – –
      IBV/48/2013 E V E N P S V N F V H K D K N N I – –
      Note: aGI-13 prototype is gCoV/AvCoV/chicken/Spain/1989Spain/1997. bGI-21 prototype is gCoV/AvCoV/chicken/ Spain//97/314.

      Table S5.  HVR3 S1 protein mutations of Moroccan IBV isolates from GI-13 and CG-21 lineages compared with reference prototypes