Figure 4个  Table 5个
    • Classification Genes
      DNA/RNA/replication/transcription/ metabolism (16) DNA polymerase (orf1), RNA polymerase subunit (orf9), DEAD-like helicase (orf13), RNase III (orf24), poxvirus late transcription factor VLTF3 like protein (orf30), thymidine kinase (orf52), RNA polymerase subunit (orf61), DNA repair exonuclease (orf67), RNA polymerase subunit (orf80), ATPase involved in DNA metabolism (orf116), CDT phosphatase transcription factor (orf117), ATPase involved in DNA repair (orf125), ATPase involved in DNA replication (orf126), yabby-like transcription factor (orf135), RNA polymerase subunit (orf143), tyrosyl-DNA phosphodiesterase (orf157)
      Packaging and assembly (2) major capsid protein (orf53), sulfhydry1 oxidase Erv1 like protein (orf71)
      Sugar and lipid metabolism (4) Glycosyl transferase (orf83), lysophospholipid acetyl transferase (orf113), patatin-like phospholipase (orf133), fatty acid elongase (orf146)
      Others (12) zinc-dependent metalloprotease (orf17), iap-like protein-1 (orf20), iap-like protein-2 (orf25), cofactor of the virion S/T kinase encoded by thioredoxin (orf58), myristylated membrane protein-like protein (orf62), serine/threonine protein kinase (orf75), ABC-type transport system permease (orf84), cathepsinB (orf109), putative zinc-finger DNA binding protein (orf111), serine/threonine protein kinase (orf124), dynein-like β chain (orf152), bro*
      Unknown (10) orf48, orf50, orf54, orf63, orf64, orf65, orf76, orf118, orf134, orf158
      Note: * HvAV-3h encodes 24bros:orf11, orf35, orf36, orf37, orf38, orf39, orf40, orf41, orf91, orf94, orf97, orf104, orf120, orf123, orf130, orf131, orf154, orf155, orf160, orf161, orf162, orf163, orf172, and orf173.

      Table 1.  Classification of the 44 genes found in all Ascoviridae isolates

    • Classification Genes
      DNA/RNA/replication/ transcription/ metabolism (4) nuclease (orf78), putative S1/P1 nuclease (orf88), helicase (orf129), putative S1/P1 nuclease (orf139)
      Others (5) iap-like protein-3 (orf47), thioredoxin-like protein (orf107), BRCA1 like protein (orf127), lipopolysaccharide-modifying enzyme (orf136), caspase-like protein (orf171)
      Unknown (16) orf5, orf8, orf14, orf19, orf21, orf22, orf23, orf26, orf27, orf31, orf34, orf43, orf55, orf66, orf74, orf81

      Table 2.  Classification of the 25 genes found in all sequenced isolates of the genus Ascovirus

    • Primer name Sequences (5′ to 3′)
      HvAV-3h_1 forward GGGCCCAGTTTCCCGCACAA
      reverse ACCGAGTCAGTGAACGCGCC
      HvAV-3h_2 forward TCAACCGCGCCGGACTGTTC
      reverse ACGCCGTCGGTGTTGACGAC
      HvAV-3h_11 forward CGCAACGTTATCGCCGCACG
      reverse GACATCGTCGGCGCTCTCGG
      HvAV-3h_12 forward ACATGGACCCCGATGCAATTC
      reverse CCGGTGGTGTCATTCAAGGA
      HvAV-3h_13 forward CTCCCTCTAGAAACGGTTAGTG
      reverse ACCACCGTATGACACATTGC

      Table S1.  Primers for polymerase chain reaction

    • BamH I Hind III Nde I Pst I Sac I Xho I
      A 35,071 33,369 25,756 19,178 27,735 37,139
      B 25,390 16,998 21,689 15,785 16,831 23,423
      C 15,809 8,440 19,446 13,999 15,089 16,842
      D 15,429 8,396 17,508 13,962 14,768 11,159
      E 13,896 7,345 12,964 11,199 14,400 8,362
      F 12,982 6,610 9,950 11,019 13,311 8,351
      G 8,511 6,577 8,118 10,411 12,051 8,344
      H 8,137 6,503 7,798 9,864 7,972 8,257
      I 7,143 6,292 7,703 8,643 6,923 7,546
      J 6,657 6,111 7,240 7,597 6,718 6,303
      K 5,497 5,622 6,836 7,589 5,828 4,833
      L 5,041 5,363 6,684 7,060 5,335 4,367
      M 4,948 5,150 5,073 6,185 5,223 4,306
      N 4,720 5,053 4,650 5,866 4,509 4,071
      O 4,261 4,894 4,240 4,457 3,998 3,984
      P 3,938 4,817 3,983 4,426 3,836 3,945
      Q 3,572 4,441 3,154 4,325 3,588 3,887
      R 2,437 4,253 2,613 4,261 3,072 3,170
      S 2,410 3,981 2,232 4,179 3,063 2,980
      T 1,855 3,888 2,213 4,121 2,826 2,554
      U 1,133 3,679 1,846 3,924 2,559 2,500
      V 1,109 3,412 1,715 1,859 2,218 2,474
      W 387 3,400 1,102 1,841 2,100 2,326
      X 186 3,385 1,075 1,817 1,805 1,721
      Y 3,132 1,051 1,716 1,369 1,597
      Z 2,649 891 1,666 1,081 1,495
      AA 2,598 834 1,185 821 1,431
      BB 2401 799 936 727 973
      CC 2050 635 877 615 582
      DD 1820 452 379 148 473
      EE 1682 269 121 452
      FF 1505 72 317
      GG 1419 237
      HH 1174 97
      II 747 11
      JJ 546 10
      KK 397
      LL 231
      MM 189
      Total 190,519 190,519 190,519 190,519 190,519 190,519

      Table S2.  Restriction enzyme digestion results of the HvAV-3h genome

    • HvAV–3h
      ORFs      		 Position aa# Product Description BLAST best match orthologous orfs number (Id%$)
      HvAV–3e HvAV–3f HvAV–3g SfAV–1a TnAV–6a DpAV–4a
      1* 1 > 3261 1086 DNA polymerase 1(98) 1(98) 1(98) 1(66) 1(44) 1(30)
      2 3456 < 4235 259 hypothetical protein 2(97) 2(95) 2(97) – 84(23) –
      3 4232 < 4846 204 hypothetical protein 3(97) 3(71) 3(96) 2(30) – –
      4 4892 < 5602 236 hypothetical protein 4(95) 4(84) 4(95) 3(38) – –
      5 5636 > 6409 257 hypothetical protein 5(99) 5(99) 5(99) 4(72) 164(40) –
      6 6466 > 7029 187 hypothetical protein 6(95) 6(94) 6(95) – – –
      7 7310 > 8545 411 hypothetical protein 7(95) 7(92) 7(94) 5(36) – –
      8 8548 > 9855 435 hypothetical protein 8(96) 8(94) 8(96) 7(39) 21(23) –
      9* 10136 < 12715 859 RNA polymerase subunit 11(99) 10(99) 11(99) 8(79) 42(61) 89(35)
      10 13173 > 13835 220 hypothetical protein 12(94) 11(91) 12(93) – – –
      11 14052 > 14927 291 bro1 13(96) 12(96) 13(96) 30(39) – –
      12 14930 > 15226 98 hypothetical protein 14(99) 13(98) 14(99) – 41(40) –
      13* 15291 > 18125 944 DEAD–like helicase 15(98) 14(98) 15(97) 9(65) 161(43) 20(36)
      14 18359 < 19489 376 hypothetical protein 17(95) 15(95) 17(96) 11(37) 160(28) –
      15 19683 > 20576 297 hypothetical protein 18(97) 16(71) 18(97) 12(31) – –
      16 20699 < 22666 655 lipase like protein 19(97) 17(95) 19(97) 13(48) – –
      17* 23086 < 24510 474 zinc–dependent metalloprotease 20(96) 19(94) 20(96) 14(59) 158(29) 29(30)
      18 24739 > 24900 53 hypothetical protein 21(93) – 21(92) – – –
      19 24976 > 26916 646 hypothetical protein 22(96) 20(88) 22(96) 15(47) 6(31) –
      20* 27150 > 27458 102 iap–like protein–1 23(98) 21(95) 23(98) 16(44) 3(28) 7(33)
      21 27539 > 28225 228 hypothetical protein 24(97) 22(98) 24(97) 17(61) 4(30) –
      22 28194 > 28784 196 hypothetical protein 25(98) 23(97) 25(98) 18(59) 5(38) –
      23 29013 > 31337 774 hypothetical protein 26(97) 24(95) 26(97) 20(51) 7(24) –
      24* 31648 > 33834 728 RNaseIII 27(98) 25(95) 27(98) 22(55) 8(41) 3(35)
      25* 33838 > 34578 246 iap–like protein–2 28(99) 26(91) 28(99) 25(40) 9(29) 7(31)
      26 34644 < 35048 134 hypothetical protein 29(99) 27(95) 29(99) 26(48) 10(36) –
      27 35064 < 37343 759 hypothetical protein 30(98) 28(94) 30(98) 27(44) 11(30) –
      28 37443 > 38507 354 hypothetical protein 31(99) 29(97) 31(98) 28(36) – –
      29 38550 > 38846 98 hypothetical protein 32(99) 30(98) 32(99) – 13(40) –
      30* 38941 > 40116 391 poxvirus late transcription factor VLTF3 like protein 33(97) 31(97) 33(97) 29(70) 17(53) 103(25)
      31 40201 < 41181 326 hypothetical protein 34(96) 32(91) 34(92) 32(33) 26(34) –
      32 41257 > 41814 185 hypothetical protein 36(93) 33(92) 36(96) – – –
      33 41899 > 42321 140 hypothetical protein 37(96) 34(98) 37(96) – – –
      34 42403 < 43311 302 hypothetical protein 39(91) 35(90) 38(92) 32(34) 26(38) –
      35 43846 > 44565 239 bro2 42(29) 36(94) 40(95) 72(26) 137(26) –
      36 44635 > 45399 254 bro3 42(33) 37(88) 42(93) – 27(27) –
      37 45418 > 46284 288 bro4 42(78) 38(68) 43(77) 80(54) 137(39) 4(23)
      38 46341 > 47420 359 bro5 40(78) 41(81) 44(74) 79(62) 165(65) 110(24)
      39 47510 > 48529 339 bro6 41(86) 40(73) 47(97) 79(64) 165(70) 98(22)
      40 48619 > 49665 348 bro7 43(88) 41(79) 44(86) 79(63) 165(62) 17(24)
      41 49782 > 50243 153 bro8 44(93) 42(84) 48(94) 79(34) 165(37) –
      42 50305 > 51009 234 hypothetical protein 45(94) 43(92) 49(96) 78(53) – –
      43 51179 > 51880 233 hypothetical protein 46(98) 44(93) 50(98) 33(54) 18(27) –
      44 51889 > 52194 101 hypothetical protein 47(96) 45(98) 51(97) – – –
      45 52227 > 52469 80 hypothetical protein 48(98) 46(98) 52(98) – – –
      46 52522 < 53295 257 hypothetical protein 49(96) 47(96) 53(95) – 34(32) –
      47 53416 > 54231 271 iap–like protein–3 51(96) 49(95) 55(96) 74(42) 32(44) –
      48* 54330 > 55790 486 hypothetical protein 52(96) 50(91) 56(96) 36(50) 157(29) 40(19)%
      49 55699 < 56031 110 GIY–YIG–like endonuclease – – – 37(65) 87(46) 77(49)
      50* 56102 < 56671 189 hypothetical protein 53(97) 52(83) 58(97) 38(56) 156(70) 63(33)
      51 56685 > 57308 207 hypothetical protein – – – 39(41) – –
      52* 57207 < 57860 217 thymidine kinase 55(98) 54(96) 60(98) 40(55) 154(33) 55(29)
      53* 57905 > 59272 455 major capsid protein 56(99) 55(97) 61(99) 41(68) 153(34) 19(23)
      54* 59343 < 60077 244 hypothetical protein 57(92) 56(94) 62(92) 42(46) 150(37) 60(35)%
      55 60091 < 60768 225 hypothetical protein 58(99) 57(99) 63(99) 43(73) 149(32 –
      56 60809 < 61537 242 hypothetical protein 59(94) 58(94) 64(95) – 148(43) 23(28)
      57 61572 < 65825 1417 chromosome segregation
      SMC like protein      		 60(95) 59(94) 65(96) 46(35) – –
      58* 66015 < 67856 613 cofactor of the virion S/T kinase encoded by thioredoxin 61(96) 60(94) 66(95) 48(68) 141(31) 8(28)
      59 67889 < 68407 172 putative nucleic acid–
      binding protein      		 62(97) 61(97) 67(98) 49(45) – –
      60 68502 < 69194 230 iap–like protein–4 63(97) 62(92) 69(98) 51(52) – –
      61* 69296 > 72763 1155 RNA polymerase subunit 64(99) 63(98) 70(99) 52(81) 138(58) 73(41)
      62* 72811 > 73689 292 myristylated membrane protein–like protein 65(26)% 64(98) 71(98) 54(60) 129(34) 65(28)
      63* 73703 > 74608 301 hypothetical protein 66(98) 65(97) 72(97) 55(67) 126(40) 35(28)
      64* 74724 > 76007 427 hypothetical protein 68(96) 66(95) 74(96) 56(44) 125(42) 64(32)
      65* 75981 < 76742 253 hypothetical protein 69(96) 67(97) 75(96) 57(54) 124(40) 9(22)%
      66 76820 < 77932 370 hypothetical protein 70(97) 68(97) 76(98) 58(47) 122(34) –
      67* 77933 < 79132 399 DNA repair exonuclease 71(98) 69(98) 77(99) 59(61) 121(50) 26(37)
      68 79169 > 79429 86 hypothetical protein – 70(95) 78(99) – 120(39) –
      69 79437 > 79673 78 hypothetical protein 72(97) 71(90) 79(97) 60(63) – –
      70 79816 < 80070 84 hypothetical protein 73(99) 72(100) 80(100) – –
      71* 80142 > 80768 208 sulfhydry1 oxidase Erv1
      like protein      		 74(96) 73(95) 81(96) 61(49) 118(33) 41(30)
      72 80785 > 81252 155 phenylalanyl–tRNA
      synthetase α subunit      		 75(96) 74(94) 82(96) – 117(31) –
      73 81249 < 81482 77 hypothetical protein – – 83(94) 62(76) – –
      74 81465 > 81989 174 hypothetical protein 76(95) 75(98) 84(95) 63(46) 116(36) –
      75* 82035 > 84473 812 serine/threonine protein kinase 77(98) 76(98) 85(98) 64(53) 115(27) 46(24)
      76* 84583 > 85797 404 hypothetical protein 78(94) 77(96) 86(94) 65(49) 113(33) 43(25)
      77 85852 > 86103 83 hypothetical protein 79(99) 78(96) 87(99) – – –
      78 86157 < 87149 330 nuclease 80(97) 79(96) 88(97) 66(54) 112(38) –
      79 87189 < 87566 125 hypothetical protein 81(97) 80(98) 89(96) – –
      80* 87588 > 88937 449 RNA polymerase subunit 82(98) 81(97) 90(98) 67(61) 110(52) 70(30)
      81 89208 > 89942 244 hypothetical protein 83(99) 82(98) 91(99) 68(43) 159(24) –
      82 90087 > 91070 327 hypothetical protein 85(98) 83(95) 92(99) – – –
      83* 91150 < 91608 152 glycosyltransferase 86(100) 84(95) 93(100) 119(35) 107(45) 52(34)
      84* 91614 < 92309 231 ABC–type transport system permease 87(94) 85(92) 94(94) 119(44) 107(44) 52(25)
      85 92863 < 93132 89 aegerolysin – 87(83) – – 29(69) –
      86 93184 < 93510 108 hypothetical protein – – – – – –
      87 93765 > 94262 165 crystal superfamily – – 96(94) – –
      88 94285 > 95067 260 putative S1/P1 nuclease 134(37) 89(91) 148(37) 75(41) 135(37) –
      89 95073 > 95849 258 hypothetical protein – 91(73) – – – –
      90 96020 < 96838 272 iap–like protein–5 89(85) 93(56) 97(74) – – –
      91 96847 < 98334 495 bro9 90(76) 94(84) 98(94) 79(46) 165(46) 98(29)
      92 99124 > 101097 657 hypothetical protein – – – – – –
      93 101371 > 102309 312 gamma_glutamyl hydrolase–like protein – 162(52) 99(95) – – –
      94 102460 < 104010 516 bro10 92(86) 96(81) 100(99) 79(48) 165(41) 34(33)
      95 104416 > 104799 127 hypothetical protein 96(52) 92(92) 101(100) 78(29) – –
      96 104926 < 105156 76 hypothetical protein – – – – – –
      97 105319 < 106827 502 bro11 93(98) 97(81) 102(97) 70(86) 165(29) 75(29)
      98 107101 > 107325 74 hypothetical protein – 98(93) – – – –
      99 107359 < 107625 88 hypothetical protein – 100(91) 105(98) – – –
      100 107626 > 108231 201 nicotinate–nucleotide pyrophosphorylase 94(90) 99(55) 106(93) – 136(55) –
      101 108420 > 108965 181 NAD–glutamate dehydrogenase 95(99) 102(77) 107(99) 76(28) – –
      102 109065 < 109457 130 hypothetical protein 96(99) 92(51) 108(99) 78(26) – –
      103 109528 < 109740 70 hypothetical protein 97(96) 103(96) 109(96) – – –
      104 110148 > 110618 156 bro12 98(98) 104(94) 110(97) – – –
      105 110656 > 110901 81 hypothetical protein 99(94) – 111(95) – – –
      106 110942 < 111634 230 hypothetical protein 101(97) 105(90) 112(97) – – –
      107 111721 < 112212 163 thioredoxin–like protein 102(99) 106(99) 113(99) 116(51) 103(34) –
      108 112251 > 112895 214 hypothetical protein – – 114(96) – – –
      109* 112798 < 114033 411 cathepsin B 103(95) 107(92) 115(95) 114(52) 102(38) 48(31)
      110 114056 < 114697 213 hypothetical protein – 108(88) 116(98) – – –
      111* 114753 > 115304 183 putative zinc–finger DNA binding protein 105(97) 109(94) 117(97) 113(42) 100(36) 108(33)
      112 115368 < 115601 77 transcription elongation
      factor S–II      		 – 110(100) 118(100) – 99(59) 82(44)
      113* 115612 > 116649 345 lysophospholipid acetyltransferase 106(97) 111(95) 119(97) 112(48) 98(41) 81(26)
      114 116650 > 116895 81 lectin–like protein 107(99) 112(85) 120(99)
      115 117019 > 118821 600 hypothetical protein 108(97) 113(94) 121(97) – 96(34) –
      116* 118944 > 120014 356 ATPase involved in DNA metabolism 109(98) 114(97) 122(98) 110(73) 95(61) 86(47)
      117* 120111 > 120680 189 CDT phosphatase
      transcription factor      		 110(99) 115(98) 123(99) 109(69) 93(52) 117(34)
      118* 120730 > 121236 168 hypothetical protein 111(98) 116(99) 124(98) 108(63) 91(41) 97(29)
      119 121334 < 122080 248 hypothetical protein 112(97) 117(96) 125(97) – 84(38) –
      120 122496 > 122975 159 bro13 113(93) 118(94) 127(93) – – –
      121 123169 > 123732 187 hypothetical protein 114(98) 119(92) 128(98) – – –
      122 124002 > 124427 141 hypothetical protein 115(99) 120(91) 129(99) 107(42) –
      123 124507 > 125022 171 bro14 116(99) 121(90) 130(98) – –
      124* 125522 < 127492 656 serine/threonine protein kinase 117(98) 122(98) 131(98) 104(63) 88(42) 36(30)
      125* 127637 > 130294 885 ATPase involved in DNA repair 118(97) 123(97) 132(97) 103(41) 77(33) 33(26)
      126* 130549 > 133707 1052 ATPase involved in DNA replication 119(99) 124(98) 133(98) 99(78) 78(45) 93(29)
      127 133919 < 134410 163 BRCA1 like protein 120(98) 125(95) 134(98) 97(62) 80(29) –
      128 134438 < 135244 268 hypothetical protein 121(97) 126(95) 135(97) 96(32) – –
      129 135347 > 136873 508 helicase 122(95) 127(88) 136(95) 95(67) 82(39) –
      130 136935 < 138371 478 bro15 123(98) 128(70) 137(76) 70(27) 34(29)
      131 138520 < 139107 195 bro16 150(40) 97(50) 139(83) 79(32) 165(29) 34(29)
      132 139265 < 140152 295 hypothetical protein 127(95) 131(85) 141(94) 94(25) – –
      133* 140305 > 141231 308 patatin–like phospholipase 128(98) 132(98) 142(96) 93(72) 67(49) 87(27)
      134* 141291 < 141950 219 hypothetical protein 129(100) 133(100) 143(99) 92(76) 60(54) 116(24)
      135* 142269 > 142646 125 yabby–like transcription factor 130(100) 134(100) 144(100) 91(84) 59(61) 22(29)
      136 142737 < 145694 985 lipopolysaccharide modifying enzyme 131(98) 135(97) 145(98) 90(54) 58(35) –
      137 145736 > 146218 160 hemolysin–like protein 132(98) 136(99) 146(98) – 57(30) –
      138 146215 < 146679 154 hypothetical protein 133(98) 137(96) 147(99) – – –
      139 146711 < 147544 277 putative S1/P1 nuclease 134(99) 138(95) 148(99) 75(42) 135(68) –
      140 147676 < 148314 212 hypothetical protein 135(99) 139(99) 149(99) – 54(42) –
      141 148373 > 148816 147 hypothetical protein 136(91) 140(93) 150(91) –
      142 148902 < 149483 193 hypothetical protein 137(97) 141(94) 151(97) – 52(35) –
      143* 149517 < 150155 212 RNA polymerase subunit 138(98) 142(98) 152(98) 89(51) 51(29) 10(26)%
      144 150188 < 150883 231 hypothetical protein 139(96) 143(95) 153(96) 88(41) – –
      145 150870 < 151187 105 hypothetical protein – 144(88) – – – –
      146* 151252 > 152064 270 fatty acid elongase 140(99) 145(98) 154(99) 87(70) 46(48) 15(34)
      147 152099 > 152794 231 DEAD–like helicase 141(91) 146(90) 155(92) – 45(29)
      148 153097 > 153723 208 hypothetical protein 142(95) 147(89) 156(94) – –
      149 153887 < 154303 138 hypothetical protein 143(89) 148(90) 157(88) – – –
      150 154409 > 155110 233 Uyr/REP helicase 144(98) 149(98) 158(98) 86(65) – 28(42)
      151 155175 < 155786 203 hypothetical protein 145(95) 150(97) 159(96) 85(50) – –
      152* 155844 > 159617 1257 Dynein–like β chain 146(99) 151(98) 160(99) 84(64) 43(34) 85(23)
      153 159843 > 160766 307 hypothetical protein 148(95) 152(87) 161(93) – 68(60) –
      154 160883 < 162403 506 bro17 149(77) 153(69) 162(88) 70(27) 165(31) 98(30)
      155 162640 < 164091 483 bro18 149(75) 154(79) 162(69) 70(27) 165(27) 67(30)
      156 164415 < 165569 384 hypothetical protein – 101(92) – – – –
      157* 165772 < 166293 173 tyrosyl–DNA phosphodiesterase 151(90) 160(87) 164(96) 119(61) 162(38) 52(29)
      158* 166315 < 166827 170 hypothetical protein 152(92) 161(89) 165(93) 119(32) 162(35) 52(26)
      159 166957 > 167190 77 hypothetical protein – – – – – –
      160 167208 < 168773 521 bro19 153(96) 163(89) 166(93) 79(45) 137(45) 34(28)
      161 169273 > 169788 171 bro20 154(90) 164(77) 167(90) 79(45) 137(43) 98(28)
      162 169835 > 170134 99 bro21 – 166(86) 43(31) – – –
      163 170259 > 171353 364 bro22 157(98) 167(91) 169(90) 79(67) 165(83) 32(26)
      164 171656 < 172540 294 hypothetical protein 158(94) 168(95) 170(96) 117(38) – –
      165 172736 < 173089 117 hypothetical protein 159(83) 169(88) 171(83) – – –
      166 173155 > 173700 181 hypothetical protein 160(95) 170(85) 172(96) – – –
      167 174138 > 174620 160 RING–finger–containing E3 ubiquitin ligase 161(91) 172(98) 175(92) – – –
      168 174608 > 175123 171 hypothetical protein 162(91) 173(91) 176(91) – – –
      169 175201 > 176178 325 hypothetical protein 163(92) 174(91) 177(92) 30(38) – –
      170 176262 > 176540 92 hypothetical protein 164(85) 175(89) 178(90) – – –
      171 177151 < 178095 314 caspase–like protein 165(91) 176(94) 179(93) 73(37) 72(22) –
      172 178429 > 179121 230 bro23 166(94) 177(95) 180(95) 72(32) 137(28) 75(24)
      173 179156 > 179908 250 bro24 167(89) 178(94) 181(95) 30(32) – –
      174 179966 < 180838 290 hypothetical protein 168(95) 181(95) 182(93) – 35(36) –
      175 181107 > 181631 174 RING–finger–containing E3 ubiquitin ligase 169(92) – 183(97) 81(41) – –
      176 181508 < 182572 354 DUF2661 superfamily – 182(93) 185(91) – – 78(27)
      177 182672 > 184042 456 S–TKc serine/threonine
      protein kinase      		 170(96) 183(96) 186(96) 82(33) – –
      178 184076 > 185143 355 hypothetical protein 171(94) 184(92) 187(93) 83(29) – –
      179 185278 < 185715 145 hypothetical protein 172(89) 185(92) 188(92) – – –
      180 185773 < 186219 148 hypothetical protein 173(95) 186(97) 189(95) – 35(26) –
      181 186437 > 186772 111 hypothetical protein 174(97) 187(98) 190(97) – – –
      182 186974 < 188161 395 hypothetical protein 175(98) 188(94) 191(97) – – –
      183 188363 < 188578 71 hypothetical protein – – 192(96) – – –
      184 188784 < 189602 272 hypothetical protein 177(92) 189(90) 193(92) 123(32) – –
      185 189703 < 190365 220 hypothetical protein – 190(88) 194(88) – – –
      Note: # The length of amino acid; $ Amino acid identity with the homologue of HvAV-3h; * Conserved Ascoviridae proteins except bro genes; % indicates the low query cover and high E value. hrs, homologous regions; ORF, open reading frame; bro, baculovirus repeat ORFs; iap, inhibitor of apoptosis protein; SfAV, Spodoptera frugiperda ascovirus; TnAV, Trichoplusia ni ascovirus; HvAV, Heliothis virescens ascovirus; DpAV, Diadromus pulchellus ascovirus; kbp, kilo base pairs.

      Table S3.  Annotation of the HvAV-3h genome