-
-
Name Sequences (5′–3′) Length (nt) T30 GGGAGAUGAAAGUCUCCAACGAUUAUAUCC 30 primer A GAATTC TAATACGACTCACTATA GGGAGATGAAAGTCTCCAACGATTATATCC GGGTCGGCATGGCATCTCCACC 75 primer B GCCGGC CCTTCTCCCTTAGCCTACGAAGTAGCCCAGGTCGGACCGCGAGGAGGTGGAGATGCCATGCCGACCC GG 75 5′-GEN GCGCGCGAATTC TAATACGACTCACTATAG 30 3′-HDV ACCGGTGCCGGC CTTCTCCCTTAG 24 Note: Restriction enzymatic sites are shown in italic, and the 24-nt shadowed sequences in primers A and B are complementary and are designed for the primer extension reaction. The singly underlined, bold, and doubly underlined sequences correspond to the T7 RNAP promoter, T30, and part of the HDV67 region, respectively. Table 1. Nucleotide sequences of the de novo synthesis RNA template T30 and the oligonucleotides used in the construction of the pRAV23-T30-HDV67 plasmid
Figure 1 个
Table 1 个