-
-
-
Virus (target) Target gene Primer Sequence ConcentrationA(nmol/L) Reference Multiplex PCR #1 HCoV-NL63 Nucleoprotein Forward AGGACCTTAAATTCAGACAACGTTCT 100 Theamboon-Alers et al., 2007 Reverse GATTACGTTTGCGATTACCAAGACT 50 Probe FAM-TAACAGTTTTAGCACCTTCCTTAAGCAACCCAAACA-TAMRA 25 HCoV-229E Nucleoprotein Forward CGCAAGAATTCAGAACCAGAG 50 Adapted from Theamboon-Alers et al., 2007 Reverse GGCAGTCAGGTTCTTCAACAA 75 Probe HEX-CCACACTTCAATCAAAAGCTCCCAAAATG-TAMRA 25 SARS-CoV Nucleoprotein Forward TGGACCCACAGATTCAACTGA 50 Adapted from Theamboon-Alers et al., 2007 Reverse GCTGTGAACCAAGACGCAGTAT 50 Probe CY5-TAACCAGAATGGAGGACGCAATGAG-BHQ2 25 Multiplex PCR #2 HCoV-OC43 Nucleoprotein Forward GCTCAGGAAGGTCTGCTCC 50 Theamboon-Alers et al., 2007 Reverse TCCTGCACTAGAGGCTCTGC 25 Probe FAM-TTCCAGATCTACTTCGCGCACATACC-TAMRA 25 MERS-CoV Nucleoprotein Forward GGCACTGAGGACCCACGTT 50 Adapted from Lu et al., 2014 Reverse TTGCGACATACCCATAAAAGCA 50 Probe CY5-CCCCAAATTGCTGAGCTTGCTCCATACA-BHQ2 25 HCoV-HKU1 Replicase 1b Forward CCTTGCGAATGAATGTGCT 50 Adapted from Dare et al., 2007 Reverse TTGCATCACCACTGCTAGTACCAC 375 Probe HEX-TGTGTGGCGGTTGCTATTATGTTAAAGCCTG-TAMRA 25 Table 1. Primers for two-tube multiplex real-time RT-PCR.
-
Target Two-tube multiplex real-time RT-PCR One-tube multiplex real-time RT-PCR Awith inline electrophoresis Range of Ct values Positive samples (%) Positive samples (%) HCoV-NL63 25-33.5 5 (1.46) 5 (1.46) HCoV-229E 26-34 10 (2.89) 10 (2.89) SARS-CoV 0 0 HCoV-OC43 26-35 6 (1.73) 5 (1.46) MERS-CoV 0 0 HCoV-HKU1 28-34.5 3 (0.87) 1 (0.29) Co-infectiona 3 (0.87) 3 (0.87) Total 25-35 24 (6.94) 21 (6.1) Note: a HCoV-NL63 and HCoV-229E (n = 1), HCoV-OC43 and HCoV-229E (n = 2). Table 2. Detection of coronavirus in 346 clinical samples.
-
Samples Ct values Monoplex real-time RT-PCRa Two-tube multiplex real-time RT-PCR Rhesus monkeys challenged with MERS-CoV Nasal swab 1 day post infection 33.86 34.00 Nasal swab 2 days post infection 32.46 32.50 Nasal swab 1 day pre infection Throat swab 2 days post infection 30.13 30.00 Throat swab 1 day pre infection Anal swab 1 day post infection 34.05 34.20 Anal swab 2 days pre infection Human patient with suspected MERS Pharyngeal swab 1 31.21 Pharyngeal swab 2 31.27 Pharyngeal swab 3 30.76 Whole blood 36.50 Note: a In-house monoplex real-time PCR for MERS-CoV N genes. The linear relationship can be described by y = –2.78x + 34.2. Table S1. Two-tube multiplex real-time RT-PCR of clinical specimens.
-
Sample(Culture hours) Ct values Monoplex real-time RT-PCRa Two-tube multiplex real-time RT-PCR 0 31.74 30.91 2 27.22 27.14 24 25.59 25.78 48 25.03 25.32 96 23.86 24.34 120 25 25.29 144 25.02 25.31 168 25.56 25.76 Uninfected cells 2 × TCID50 of HCoV-HKU1 25 25.29 Note: a In-house monoplex real-time PCR for HCoV-HKU1 replicase 1b. The linear relationship can be described by y = –3.2x + 33.4. Table S2. Detection of HCoV-HKU1 in the supernatant of infected cultures of human airway epithelial cells.
Figure 2 个
Table 4 个