Figure 1个  Table 1
    • Target 5′–3′ Position Region Length AR (RAR) Number of mutation strain
      AAUAGUUUAAAAAUUACAGAAGA 6509–6531 Orf1ab 23 20 (20) 1
      UCCUUCUUUAGAAACUAUACA 7168–7188 Orf1ab 21 18 (12.6) 0
      UGGUUUCACUACUUUCUGUUU 11, 997–12, 017 Orf1ab 21 15 (10.5) 0
      UUCACUACUUUCUGUUUUGCU 12, 001–12, 021 Orf1ab 21 15 (10.5) 0
      AUGUCAUCCCUACUAUAACUCAAA 15, 041–15, 064 Orf1ab 24 18 (18) 0
      UUAAAAUAUAAUGAAAAUGGA 22, 391–22, 411 S 21 18 (12.6) 0
      CUUGAAGCCCCUUUUCUCUAUCUUU 25, 693–25, 717 Orf3a 25 18 (12.6) 0
      CAACUAUAAAUUAAACACAGA 27, 128–27, 148 M 21 19 (19) 2
      UUGAAUACACCAAAAGAUCACAUU 28, 688–28, 711 N 24 18 (18) 0
      The bold and underlined characters indicate the SNP found in different strains.

      Table 1.  siRNA target sequence in plus strand of coronavirus (MN908947).