Figure 2个  Table 4个
    • Primers bp Tm %GC Product
      H1 1006 pb
      H1F 5´GGTAGATGGATGGTACGGTTA3′ 21 53.4℃ 47.6
      H1R 5´GGTCCACCAACT TGAGAAATG3′ 21 53.9℃ 47.6
      N1 754 pb
      N1F 5´TAAATGACAAACATTCCAATGG3′ 22 49.5℃ 31.8
      N1R 5´AACTATCACAGACAATAATA3′ 20 43.0℃ 25

      Table 1.  Primers and PCR conditions for diagnosis of SIV-H1N1

    • Agent ELISA Kit
      PRRSV IDEXX PRRSV X3 Ab Test
      Mycoplasma hyopneumoniae IDEXX M. hyo. Ab Test
      Actinobacillus pleuroneumoniae ID VET -ID Screen® APP Screening (1-2-4-7-9-11)
      Circovirus Porcino tipo 2 Ingezim PCV, INGENASA

      Table 2.  ELISA kits used to determine the presence of PRDC

    • Virus Region MDCK Cells Embryo chicken Eggs
      A/SW/COL0102/2009/H1N1 OCCIDENTAL + -
      A/SW/COL0201/2009/H1N1 ANTIOQUIA - +
      A/SW/COL0301/2009/H1N1 ANTIOQUIA - +
      A/SW/COL0502/2009/H1N1 OCCIDENTAL + -
      A/SW/COL0602/2009/H1N1 OCCIDENTAL + -
      A/SW/COL0701/2009/H1N1 ANTIOQUIA + +
      A/SW/COL1002/2009/H1N1 OCCIDENTAL + +

      Table 3.  Swine influenza virus isolated by region

    • PRDC Negative SIV-H1N1p farms Positive SIV-H1N1p farms
      App 64.5% 81.1%
      Myh 56.9% 79.4%
      PCV2 87.5% 96.0%
      PRRSVV 15.3% 1.6%

      Table 4.  PRDC percentage in SIV-H1N1p-positive and-negative farms