-
-
-
-
-
-
Reaction Primer name Sequence (from 5′ to 3′) Position Amplification DENV E1 Forward TGCCATAGGAACATCCATCAC 863-883 Amplification DENV E2 Reverse TCCCAATGGCTGCTGATAGTC 2495-2462 Sequencing DENV E1 Forward TGCCATAGGAACATCCATCAC 863-883 Sequencing DENV E2 Reverse TCCCAATGGCTGCTGATAGTC 2495-2462 Sequencing DENV E3 CGGAAAAGGTAGCCTAATAACG 1259-1280 Table 1. Primers used for amplifying and sequencing the complete DENV-1 envelope gene
-
Strain Date of occurrence GenBank accession number District GZ/E24 2014-10-31 KT037099 Yuexiu GZ/E25 2014-11-10 KT037100 Yuexiu GZ/E27 2014-11-20 KT037101 Lianshan GZ/E31 2014-11-5 KT037102 Yuexiu GZ/E101 2014-11-25 KT037103 Liwan GZ/E99 2014-10-5 KT037104 Nanhai GZ/E98 2014-10-5 KT037105 Yuexiu GZ/E86 2014-10-23 KT037106 Panyu GZ/E80 2014-10-29 KT037107 Yuexiu GZ/E79 2014-11-3 KT037108 Baiyun GZ/E66 2014-11-9 KT037109 Tianhe GZ/E19 2014-11-20 KT037110 Baiyun GZ/E6 2014-10-25 KT037111 Yuexiu GZ/37 2014-10-31 KT037112 Yuexiu GZ/E9 2014-10-27 KT037113 Yuexiu GZ/E38 2014-11-3 KT037114 Yuexiu GZ/E41 2014-11-9 KT037115 Tianhe Table 2. Newly isolated DENV-1 strains from Guangzhou during 2014. The GenBank accession numbers and the districts for the strains are shown
Figure 5 个
Table 2 个
