Figure 9个  Table 2个
    • Bacteriophage Length (bp) # Matched Reads # Total Reads Match Percentage Min Coverage Max Coverage
      IME-SA1 140, 218 2, 251, 761 2, 405, 205 93.62% 676 5, 516
      IME-SA2 140, 906 296, 039 288, 122 97.32% 194 1, 762
      IME-SA118 139, 750 91, 643 142, 123 64.48% 36 529
      IME-SA119 141, 026 2, 571, 317 2, 642, 206 97.32% 107 88, 881

      Table 1.  Summary of IME-SA1/2/118/1192 genome sequencing and assembly.

    • Bacteriophage Strand Ave. Freq. Ter. Freq. Occurrence Frequency Ratio Terminal Sequence
      IME-SA1 Positive 8 1473 184 GGAATTCTTTTACCTCTCTC
      IME-SA2 Positive 1 650 650 GGAATTCTTTTACCTCTCTC
      IME-SA118 Positive 1 85 85 GGAATTCTTTTACCTCTCTC
      IME-SA119 Positive 7 25894 3699 GGAATTCTTTTACCTCTCTC
      Note: Ave. Freq. – Average Frequency; Ter. Freq. – Terminal Frequency.

      Table 2.  Occurrence frequency of IME-SA1/2/118/119 terminal sequences.