HTML
-
The mutated region in the SAP domain of rA-SAP-FMDV was confirmed by sequencing analysis. A low MOI leads to infection of a percentage of cells, resulting in these infected cells signaling adjacent, uninfected cells via cytokines in order to activate antiviral genes, including secreted innate immune proteins. To study the signal transduction pathways and proteins involved, infections in this study were performed at 1 MOI. To compare the replication status of rA-FMDV and rA-SAP-FMDV in porcine PK15 and SK6 cells, the cells were infected with equal concentrations of rA-FMDV or rA-SAP-FMDV. The samples were collected 12-h post-infection, and the titers determined by TCID50 assay. The results showed that rA-FMDV replicated more quickly relative to rA-SAP-FMDV in both PK15 and SK6 cells (Figure 1B), indicating that the SAP mutation decreased FMDV replication in porcine PK15 and SK6 cells, with a larger decrease observed in SK6 cells.
-
To explore the differentially expressed genes involved in the altered pathogenicity observed in SK6 cells infected with FMDV containing the SAP mutation, rA-FMDV-infected and rA-SAP-FMDV-infected SK6 cells were collected at 6-h post-infection, and transcriptome analysis was performed. After a stringent quality check and filtering of the data (FDR ≤ 0.001 and fold-change ≥ 2), 20, 421 genes were detected, with 1, 853 differentially expressed genes identified. A total of 1, 670 and 183 genes were differentially upregulated and downregulated, respectively, between rA-SAP-FMDV-and rA-FMDV-infected SK6 cells (Supplementary Figure S1, S2). The expression of 117 transcription factor-related genes involved in 12 biological processes, 114 immune regulation-related genes participating in 40 immune-regulatory processes, 69 cytokine-related genes, including 20 involved in cytokine-production and -secretion processes, 12 inflammatory response-related genes, and 19 apoptosis-related genes were significantly altered (Table 1, Supplementary Table S2-S5). The distinctively different expression profiles of these genes may explain the decreased pathogenicity observed following infection with rA-SAP-FMDV. An analysis of the available literature indicated that the majority of the differentially expressed genes correlating with antiviral responses included (Table 2): 1) genes involved in transcriptional regulation (EIF4A2, EIF5B, EIF3J, NFKBIA, and NFKBIZ); 2) genes involved in the regulation of immune response (IFIT1, ITCH, IL7R, JAK2, LTB, TNFSF10, IL7, BLM, IFIT1, IL18, IL6, and FOS); 3) cytokine-related genes (IL1, IL6, IL20, TNF, CCL2, CCL20, CXCL10, CXCL2, CCL3L1, CCL4, CCL5, and CXCL11); 4) genes involved in the regulation of inflammation and chemokine production (TNF, CCL5, IL1A, IL6, IL6ST, CCL2, and ITCH); and 5) genes involved in apoptosis (BLM, CASP3, BRCA2, PMAIP1, CD38, MAP3K5, CUL5, TNFSF10, and XIAP).
Function Total gene number Up-or down-regulated gene number Up-regulated Down-regulated transcription factor-related genes 117 109 8 immune regulation-related genes 114 104 10 cytokine-related genes 69 62 7 inflammatory response-related genes 12 11 1 apoptosis-related genes 19 18 1 Table 1. Summary of differential expressed genes
Gene Fold Gene description Function EIF4A2 2.23 Eukaryotic initiation factor 4A-Ⅱ RNA helicase activity; adenyl ribonucleotide binding EIF5B 3.11 Eukaryotic translation initiation factor 5B Translation factor activity, nucleic acid binding EIF3J 2.47 Eukaryotic translation initiation factor 3 subunit
J-like isoform 1Translation factor activity, nucleic acid binding NFKBIA 3.83 NF-kappa-B inhibitor alpha Transcription factor binding NFKBIZ 3.47 NF-kappa-B inhibitor zeta Transcription cofactor activity, protein binding IFIT1 3.74 Interferon induced protein with tetratricopeptide repeats 1 RNA binding, protein binding ITCH 2.87 Itchy E3 ubiquitin protein ligase Chemokine receptor binding, ubiquitin protein ligase activity IL7R 4.32 Interleukin 7 receptor Cytokine receptor activity JAK2 2.27 Janus kinase 2 Kinase binding, cytokine receptor, protein kinase activity LTB 13.15 Lymphotoxin-beta Tumor necrosis factor receptor superfamily bindin TNFSF10 3.67 Tumor necrosis factor superfamily member 10 Cation binding, tumor necrosis factor receptor binding IL7 2.31 PREDICTED: interleukin-7 isoform 3 Cytokine receptor binding BLM 3.15 Bloom syndrome protein ATP-dependent DNA helicase activity, double-stranded DNA binding IL18 2.27 Interleukin 18 Receptor binding, cytokine activity IL6 11.05 Interleukin 6 Cytokine receptor binding, cytokine activity FOS 3.78 FBJ osteosarcoma oncogene Nucleic acid binding transcription factor activity, protein dimerization activity IL1 3.11 Interleukin 1 Cytokine activity IL20 27.75 Interleukin 20 Cytokine receptor binding, cytokine activity TNF 20.89 Tumor necrosis factor Tumor necrosis factor receptor superfamily binding, sequence-specific DNA binding CCL2 5.73 C-C motif chemokine ligand 2 Kinase activity, chemokine receptor binding CCL20 7.62 C-C motif chemokine ligand 20 Cytokine activity, chemokine receptor binding CXCL10 5.89 Chemokine (C-X-C motif) ligand 10 Protein kinase regulator activity, cytokine activity CXCL2 2.38 Chemokine (C-X-C motif) ligand 2 Cytokine activity, chemokine activity CCL3L1 6.17 C-C motif chemokine ligand 3 like 1 CCR chemokine receptor binding, chemokine activity CCL4 15.34 C-C motif chemokine ligand 4 Cytokine activity, chemokine activity CCL5 2.58 C-C motif chemokine ligand 5 CCR chemokine receptor binding, chemokine activity, protein tyrosine kinase activator activity CXCL11 6.17 C-X-C motif chemokine ligand 11 Heparin binding, chemokine activity IL1A 3.11 Interleukin-1 alpha precursor Transition metal ion binding, cytokine receptor binding IL6ST 3.58 Interleukin 6 signal transducer Ciliary neurotrophic factor receptor activity, cytokine receptor binding CASP3 2.08 Caspase 3 Endopeptidase activity, cyclin-dependent protein kinase regulator activity BRCA2 5.42 Breast cancer 2 Structure-specific DNA binding, histone acetyltransferase activity PMAIP1 2.78 Phorbol-12-myristate-13-acetate-induced protein 1 Protein binding CD38 2.51 Cluster of differentiation 38 Transferase activity, NAD(P)+ nucleosidase activity MAP3K5 2.23 Mitogen-activated protein kinase kinase kinase 5 Metal ion binding, phosphatase binding, apoptotic protease activator activity CUL5 3.23 Cullin 5 Signal transducer activity, enzyme binding XIAP 2.59 X-linked inhibitor of apoptosis Transition metal ion binding, cysteine-type endopeptidase inhibitor activity Note: A minimum of twofold change (P < 0.0001, Q < 0.0001) was used as the standards for selecting genes of interest. Table 2. List of genes that displayed significant differential expression at WT and SAP mutant FMDV-infected SK6 cells
-
To further confirm and validate the transcriptome analysis results, we performed qPCR analysis to determine the reproducibility of the differential gene expression. A selected group of genes for which we had an established method available in our laboratory (with established primers and melting/annealing temperatures previously) were chosen for analysis. Six upregulated genes (CCL4, CCL2, IL6, IL7, IL18, and EGR1) and four downregulated genes (SRPX2, CREB5, RASAL1, and RIN2) were analyzed, and qPCR results confirmed the differential expression identified between rA-SAP-FMDV-and rA-FMDV-infected cells. As shown in Figure 2, the qPCR results corresponded with transcriptome analysis results and, while some fold-change differences were observed between results from each method, similarities in the overall expression profiles were revealed.
Figure 2. Validation of differentially expressed genes identified by transcriptome analysis through qPCR detection. Six upregulated and four downregulated genes were detected in an independent infection experiment undertaken in order to validate transcriptome analysis results. The expression profiles of the 10 selected genes were consistent between the transcriptome-analysis and qPCR-detection results. Results are presented as the mean ± standard error from three independent experiments.
-
Infection with FMDV containing the SAP-domain mutation altered gene expression in SK6 cells, thereby affecting various biological processes and signal transduction pathways, and resulting in blocked viral replication and decreased pathogenicity. To systematically analyze the functional characterization of the differentially expressed genes and pathways associated with the FMDV Lpro SAP domain, GO analysis and pathway annotation were conducted. The results indicated that the differentially expressed genes were involved in metabolism, cell cycle processes, and cellular component organization or biogenesis processes (Supplementary Figure S3), and functional analysis revealed that many of these genes were involved in nucleotide binding and functions associated with nucleic acids (Supplementary Figure S4). Cellular component annotation results are shown in Supplementary Figure S5.
Pathway analysis indicated that 35 pathways were altered in rA-SAP-FMDV-infected cells as compared with rA-FMDV-infected cells, including regulation of actin cytoskeleton formation, endocytosis, phagosome formation, chemokine-signaling pathways, the cell cycle, the retinoic acid-inducible gene 1-like receptor signaling pathway, the NF-κB signaling pathway, and the nucleotide-binding oligomerization domain-like receptor signaling pathway (Supplementary Figure S6). The potential host targets for Lpro and the protein-protein interaction pathways involved are shown in Figure 3. These findings suggested that expression of these genes might potentially result in decreased rA-SAP-FMDV replication.
Viral replication in porcine cells differs between FMDV containing wild-type or mutant SAP domain
Differentially expressed genes between SK6 cells infected with FMDV containing wild-type or mutant SAP domain
Validation of differentially expressed genes by qPCR
Functional characterization of differentially expressed genes and pathways affected by infection with FMDV containing the SAP mutation
-
Gene Primers(5′→3′) CCL4 Forward: CACCTCCTGCTGCTTCACATA Reverse: CAGACCTGCCTGCCCTTTT CCL2 Forward: GTCACCAGCAGCAAGTGTCCT Reverse: ATGTGCCCAAGTCTCCGTTTA IL6 Forward: GACAAAGCCACCACCCCTAA Reverse: CTCGTTCTGTGACTGCAGCTTATC IL7 Forward: GGGATGGATGAAACAGAAGG Reverse: GCTACTGGCAACAGAACAAGG' IL18 Forward: GCACCTCAGACCGTATTTATT Reverse: CATCATGTCCAGGAACACTTC EGR1 Forward: TCAACACCACCTACCAGTCCCA Reverse: GATCTTGGTATGCCTCTTGCGTT SRPX2 Forward: AACGTGGTATGCAGGTTCAGG Reverse: GTAGTCACAGCGGGAGTCAAGA CREB5 Forward: TATCTTCCCTGCTACATCTTCACA Reverse: AACGCAGCCTTCAACCTCATT RASAL1 Forward: GTGAAAGTGGACGACGAGGTGG Reverse: GGGAAGCGTGTCTTCTTGATGG RIN2 Forward: CCTTGAAGTTGCCTTATGCTGTTT Reverse: GCTACGTTCCCATGTGGGTGAT GAPDH Forward: ACATGGCCTCCAAGGAGTAAGA Reverse: GATCGAGTTGGGGCTGTGACT Table S1. The qPCR primers used in this study
Gene function description Up-regulated genes Down-regulated genes Gene number Gene name list Gene number Gene name list Transcription factor complex 9 ING2, CNOT7, TAF13, TAF9B, MNAT1, RB1, NFYB, GTF2A1, TAF2 0 - Transcription factor binding 22 HES1, KLF4, LOC100154750, GTF2A1, LOC100739605, MDFIC, MTDH, MED13, JMJD1C, PRDM5, LOC100626982, NFYB, EGR2, NRIP1, NFKBIA, SIRT1, HMGB1, CAND1, EIF4A2, EIF4A2, EIF5B, EIF3J 0 - Protein binding transcription factor activity 34 FGF2, JMY, SP100, IFNB1, NPAT, MTDH, CIR1, SCAI, USP16, NFE2, GABPA, SIRT1, C1D, LOC102161761, LOC102160069, TRIP11, LOC100154750, MYSM1, RB1, SS18, LOC100739605, LOC100622863, TAF9B, TMF1, MED13, NMI, COPS2, LOC102166221, TBL1XR1, CASP8AP2, NRIP1, AEBP2, KMT2E, SKIL 3 DYRK1B, PIR, TFCP2L1 Transcription factor binding transcription factor activity 34 FGF2, JMY, SP100, IFNB1, NPAT, MTDH, CIR1, SCAI, USP16, NFE2, GABPA, SIRT1, C1D, LOC102161761, LOC102160069, TRIP11, LOC100154750, MYSM1, RB1, SS18, LOC100739605, LOC100622863, TAF9B, TMF1, MED13, NMI, COPS2, LOC102166221, TBL1XR1, CASP8AP2, NRIP1, AEBP2, KMT2E, SKIL 3 DYRK1B, PIR, TFCP2L1 Nucleic acid binding transcription factor activity 60 KLF4, ZHX1, EGR4, ZNF24, LOC102159255, TFAM, NFIA, EGR2, GABPA, GATA3, NFE2L2, HDAC1, HDAC2, HES1, PAXBP1, ZC3H8, TAF13, CREBRF, GATA2, TOPOⅡ, TOP2B, RBPJ, MYNN, EHF, DMTF1, ZNF84, ZBTB38, AHR, HMGB1, ZNF197, CNOT7, GCFC2, BTAF1, LOC102163244, SLC30A9, NPAT, LOC100737142, CIR1, ZNF189, ETV1, FOXN2, TBX21, SIX4, ZEB2, NFYB, EGR1, ZNF287, ARID4A, RB1, BTG2, FOS, LOC100622863, BLZF1, LOC100520527, LOC100515279, NR1D2, SCML2, HIF1A, LOC100626982, POU3F2 5 ARNT2, NR4A2, RCAN1, ZNF71, TFCP2L1 Ligand-activated sequence-specific DNA binding RNA polymerase Ⅱ transcription factor activity 1 NR1D2 1 NR4A2 Sequence-specific DNA binding transcription factor activity 5 HES1, BTG2, HIF1A, NR1D2, FOXN2 1 NR4A2 Sequence-specific DNA binding RNA polymerase Ⅱ transcription factor activity 4 BTG2, HIF1A, NR1D2, FOXN2 1 NR4A2 Positive regulation of sequence-specific DNA binding transcription factor activity 8 MALT1, TNF, KRAS, TAB3, CHUK, LOC100620995, NFKBIA, MTDH 0 - Regulation of sequence-specific DNA binding transcription factor activity 10 MALT1, ITCH, TNF, KRAS, TAB3, CHUK, LOC100620995, NFKBIA, LOC100153617, MTDH 1 LOC100515993 Negative regulation of sequence-specific DNA binding transcription factor activity 3 NFKBIA, LOC100153617, ITCH 1 LOC100515993 Regulation of transcription factor import into nucleus 2 NFKBIA, TNF 0 - Table S2. Differentially expressed genes involved in transcription-related functions
Gene function description Up-regulated genes Down-regulated genes Gene number Gene name list Gene number Gene name list Negative regulation of immune effector process 4 SOCS5, IFIT1, ITCH, IL7R 1 TGFB3 Production of molecular mediator of immune response 8 MALT1, LOC100621191, TNF, XRCC4, LOC100620995, LOC100739713, IL7R, MSH2 0 - Immune system process 94 BMPR1A, IL18, CASP3, CXCL10, SEMA3C, TGFBR1, MASP2, IFNB1, IFIT1, CCL5, ROCK1, S100A12, LOC100739781, LOC100625180, LOC100518921, CD79A, XRCC4, CD84, GATA3, IL7R, DPP8, HES1, LOC102161761, ZC3H8, CSF2, TNF, TBK1, TAB3, PIK3CA, IRG6, LOC100736872, RBPJ, BRCA2, ATM, CCL3L1, LOC100620995, AHR, HMGB1, APC, MSH2, SLAMF7, CCL20, S100A9, ADAM10, KRAS, JAK2, LTB, TNFSF10, IL7, BLM, LOC100622217, IL1RAP, SIX4, LOC100622970, LOC100738058, RTKN2, NCK1, MAP3K8, EGR1, CHUK, IL1A, LOC100739713, ANGPT1, KITLG, LOC102163753, LOC100621191, LOC100627112, RB1, MSH3, CXCL2, UBD, BMI1, FOS, LOC100628215, STXBP3, MALT1, CCL2, MTAP, TNFSF15, CFH, CSF1, CD38, APOBEC1, NFKBIA, RICTOR, CCL4, KMT2E, CXCL11, ITGA6, LOC100739007, IL6ST, SKIL, IL6, LOC100620730 6 SUSD2, GRB7, MAP2K6, GPX2, LOC102166152, LOC100522330 Cytokine production involved in immune response 4 MALT1, LOC100620995, LOC100621191, TNF 0 - Somatic recombination of immunoglobulin genes involved in immune response 3 LOC100739713, MSH2, XRCC4 0 - Somatic diversification of immunoglobulins involved in immune response 3 LOC100739713, MSH2, XRCC4 0 - Immunoglobulin production involved in immunoglobulin mediated immune response 3 LOC100739713, MSH2, XRCC4 0 - Regulation of immune system process 48 LOC100737466, IL18, CASP3, ITCH, ADAM10, MASP2, IFNB1, IFIT1, CCL5, EDN1, IL7, BLM, LOC100622217, CD79A, TBX21, LOC100622970, LOC100738058, NCK1, MAP3K8, CHUK, IL7R, SOCS5, LOC100627112, LOC100737558, TNF, TBK1, RB1, TAB3, PIK3CA, FOS, ELMOD2, LOC100628215, MALT1, CCL2, HIF1A, ATM, ACVR2A, CFH, CSF1, CD38, RICTOR, LOC100620995, NFKBIA, KMT2E, DDX58, LOC100739007, IL6, APC 5 TNFSF4, MAP2K6, SEMA7A, TGFB3, LOC102161418 Somatic diversification of immune receptors via germline recombination within a single locus 5 LOC100739713, HMGB1, MSH3, MSH2, XRCC4 0 - Immune response 19 IL18, LOC100621191, TNF, MASP2, IFNB1, IFIT1, BMI1, IL7, STXBP3, S100A12, MALT1, CCL2, CFH, XRCC4, LOC100620995, LOC100739713, GATA3, IL6ST, MSH2 1 GPX2 Adaptive immune response 10 MALT1, IL18, TNF, MASP2, XRCC4, LOC100620995, LOC100739713, GATA3, IL6ST, MSH2 0 - Somatic diversification of immune receptors 5 LOC100739713, HMGB1, MSH3, MSH2, XRCC4 0 - Immune system development 29 KITLG, ZC3H8, RB1, MSH3, TGFBR1, BMI1, JAK2, LTB, RBPJ, BLM, LOC100628215, LOC100739781, MALT1, BRCA2, ATM, LOC100518921, CD79A, SIX4, MTAP, RTKN2, XRCC4, EGR1, CHUK, LOC100739713, HMGB1, IL7R, APC, ANGPT1, MSH2 ; 1 LOC102166152 Myeloid cell activation involved in immune response 2 S100A12, STXBP3 0 - Somatic diversification of immune receptors via somatic mutation 2 LOC100739713, MSH2 0 - Adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains 9 MALT1, IL18, TNF, MASP2, XRCC4, LOC100620995, LOC100739713, GATA3, MSH2 0 - Regulation of production of molecular mediator of immune response 2 TBX21, TNF 2 SEMA7A, TGFB3 Negative regulation of immune system process 5 CASP3, SOCS5, IFIT1, ITCH, IL7R 1 TGFB3 Regulation of immune effector process 11 LOC100737466, SOCS5, TBX21, ITCH, TNF, IFNB1, IFIT1, DDX58, ELMOD2, IL6, IL7R 2 TGFB3, SEMA7A Immunoglobulin mediated immune response 5 LOC100739713, TNF, MASP2, MSH2, XRCC4 0 - Positive regulation of immune system process 28 IL18, SOCS5, LOC100627112, ITCH, TBK1, ADAM10, TAB3, MASP2, IFNB1, PIK3CA, FOS, CCL5, EDN1, BLM, LOC100622217, TBX21, CD79A, CFH, LOC100622970, LOC100738058, NCK1, MAP3K8, CD38, RICTOR, CHUK, LOC100620995, NFKBIA, IL6 2 TNFSF4, MAP2K6 Regulation of cytokine production involved in immune response 0 - 2 SEMA7A, TGFB3 Innate immune response 2 CCL2, IFIT1 0 - Activation of innate immune response 8 LOC100622970, TBK1, TAB3, LOC100738058, CHUK, LOC100620995, NFKBIA, FOS 1 MAP2K6 Innate immune response-activating signal transduction 8 LOC100622970, TBK1, TAB3, LOC100738058, CHUK, LOC100620995, NFKBIA, FOS 1 MAP2K6 Immune effector process 14 S100A12, STXBP3, MALT1, CFH, TNF, MASP2, XRCC4, APOBEC1, LOC100620995, IRG6, KMT2E, LOC100739713, GATA3, MSH2 0 - Positive regulation of innate immune response 8 LOC100622970, TBK1, TAB3, LOC100738058, CHUK, LOC100620995, NFKBIA, FOS 1 MAP2K6 Regulation of innate immune response 8 LOC100622970, TBK1, TAB3, LOC100738058, CHUK, LOC100620995, NFKBIA, FOS 1 MAP2K6 Regulation of immune response 17 SOCS5, TBK1, TAB3, MASP2, PIK3CA, FOS, TBX21, CD79A, LOC100622970, CFH, LOC100738058, NCK1, CD38, CHUK, LOC100620995, NFKBIA, IL6 3 TGFB3, MAP2K6, SEMA7A Immune response-activating cell surface receptor signaling pathway 7 NCK1, CD38, PIK3CA, NFKBIA, LOC100620995, CHUK, CD79A 0 - Immune response-regulating cell surface receptor signaling pathway 7 NCK1, CD38, PIK3CA, NFKBIA, LOC100620995, CHUK, CD79A 0 - Activation of immune response 14 CD79A, CFH, LOC100622970, TBK1, TAB3, MASP2, LOC100738058, NCK1, CD38, PIK3CA, CHUK, LOC100620995, NFKBIA, FOS 1 MAP2K6 Immune response-activating signal transduction 12 CD79A, LOC100622970, TBK1, TAB3, LOC100738058, NCK1, CD38, PIK3CA, CHUK, LOC100620995, NFKBIA, FOS 1 MAP2K6 Immune response-regulating signaling pathway 12 CD79A, LOC100622970, TBK1, TAB3, LOC100738058, NCK1, CD38, PIK3CA, CHUK, LOC100620995, NFKBIA, FOS 1 MAP2K6 Positive regulation of immune response 14 CD79A, CFH, LOC100622970, TBK1, TAB3, MASP2, LOC100738058, NCK1, CD38, PIK3CA, CHUK, LOC100620995, NFKBIA, FOS 1 MAP2K6 Humoral immune response mediated by circulating immunoglobulin 2 TNF, MASP2 0 - Humoral immune response 3 CFH, TNF, MASP2 0 - Cell activation involved in immune response 2 S100A12, STXBP3 0 - Leukocyte activation involved in immune response 2 S100A12, STXBP3 0 - Positive regulation of immune effector process 3 SOCS5, TBX21, IL6 0 - Table S3. Differentially expressed genes involved in immune regulation
Gene function description Up-regulated genes Down-regulated genes Gene number Gene name list Gene number Gene name list Cytokine receptor binding 25 KITLG, CSF2, IL20, ITCH, TNF, TGFBR1, IFNB1, CCL5, JAK2, LTB, TNFSF10, IL7, LOC100739781, CCL2, IL1RAP, TNFSF15, CSF1, CASP8AP2, IL1A, LIFR, LOC100739007, IL6ST, IL6, LOC100620730, ANGPT1 3 TGFB3, TNFSF4, LOC100515993 Cytokine activity 9 CCL2, CCL20, CXCL10, CXCL2, CCL3L1, CCL4, CCL5, CXCL11, LOC100620730 0 - Cytokine receptor activity 5 IL1RAP, LIFR, IL12RB2, IL6ST, IL7R 0 - Positive regulation of cytokine production 18 CSF2, LOC100737466, IL18, TNF, TBK1, IFNB1, POLR3G, NOX1, IL12RB2, MALT1, HIF1A, LOC100622970, LOC100620995, IL1A, DDX58, GATA3, IL6, IL6ST 1 TNFSF4 Regulation of cytokine production 26 CSF2, LOC100737466, IL18, ITCH, TNF, TBK1, IFNB1, IFIH1, POLR3G, NOX1, IL12RB2, LTB, RNF125, ATG5, MALT1, HIF1A, LOC100625180, TNFSF15, LOC100622970, ZNF287, LOC100620995, IL1A, GATA3, DDX58, IL6ST, IL6 5 LOC780431, TGFB3, TNFSF4, SEMA7A, ACP5 Response to cytokine stimulus 17 CASP3, SP100, TNF, ADAM10, UBD, IFIT1, IFIT3, RPS6KB1, EDN1, ACSL4, CCL2, IFIT2, EGR1, CD38, LIFR, HMGB1, IL6 2 LOC100515993, LOC102161418 Cytokine production involved in immune response 4 MALT1, LOC100620995, LOC100621191, TNF 0 - Regulation of cytokine secretion 3 IL1A, TNFSF15, TNF 1 TNFSF4 Negative regulation of cytokine production 9 ATG5, LOC100737466, ITCH, LOC100622970, TNF, TBK1, IFIH1, DDX58, RNF125 3 TGFB3, TNFSF4, ACP5 T cell cytokine production 2 MALT1, LOC100620995 0 - Cytokine production 9 MALT1, IL18, HIF1A, IL1RAP, LOC100621191, TNF, LOC100620995, IL12RB2, JAK2 1 ACP5 Negative regulation of cytokine-mediated signaling pathway 2 CCL5, IL6ST 0 - Negative regulation of response to cytokine stimulus 2 CCL5, IL6ST 0 - Cytokine-mediated signaling pathway 9 EGR1, CCL2, IFIT1, LIFR, IFIT3, SP100, IL6, TNF, IFIT2 1 LOC102161418 Cellular response to cytokine stimulus 9 EGR1, CCL2, IFIT1, LIFR, IFIT3, SP100, IL6, TNF, IFIT2 1 LOC102161418 Positive regulation of cytokine biosynthetic process 6 LOC100625180, IL1A, LTB, LOC100622970, TNF, TBK1 0 - Regulation of cytokine production involved in immune response 0 - 2 SEMA7A, TGFB3 Regulation of cytokine biosynthetic process 7 LOC100625180, IL1A, LTB, IL6, LOC100622970, TNF, TBK1 0 - Regulation of cytokine-mediated signaling pathway 4 SOCS1, CCL5, JAK2, IL6ST 0 - Regulation of response to cytokine stimulus 4 SOCS1, CCL5, JAK2, IL6ST 0 - Table S4. Differentially expressed genes involved in cytokine-related functions
Gene function description Up-regulated genes Down-regulated genes Gene number Gene name list Gene number Gene name list Chronic inflammatory response 8 TNF, PTGER3, PLA2G4A, CCL5, IL1A, IL6, IL6ST, PTGS2 0 - Acute inflammatory response 11 HIF1A, TNF, PTGER3, IFNB1, PLA2G4A, CCL5, IL1A, HMGB1, IL6, IL6ST, PTGS2 1 GPX2 Inflammatory response 1 TNF 1 GPX2 Inflammatory response to antigenic stimulus 8 TNF, PTGER3, PLA2G4A, CCL5, IL1A, IL6, IL6ST, PTGS2 0 - Chemokine receptor binding 4 CCL2, CCL5, ITCH, LOC100620730 0 - CCR chemokine receptor binding 2 CCL2, CCL5 0 - Regulation of execution phase of apoptosis 5 BRCA2, LOC100624979, LOC100739713, PMAIP1, MSH2 0 - Induction of apoptosis 13 CD38, LOC100738156, LOC100622580, MAP3K5, CUL5, TNFSF10, XIAP, TNF, BLM, BCLAF1, CASP3, CASP4, CASP8AP2 1 LOC102161387 Table S5. Differentially expressed genes involved in inflammation, chemokine production-, and apoptosis-related functions
Figure S1. GO analysis of the immune-related genes indicating altered expression in rA-SAP-FMDV-infected SK6 cells as compared with rA-FMDV-infected SK6 cells. The X-axis indicates the correspondent number of genes.
Figure S2. GO analysis of the transcription factor-, inflammatory response-, apoptosis-and cytokine-related genes showing altered expression in rA-SAP-FMDV-infected SK6 cells as compared with rA-FMDV-infected SK6 cells. The X-axis indicates the correspondent number of genes.
Figure S3. Biological processes derived from GO annotations for the differentially expressed genes. The X-axis indicates the correspondent number of genes.
Figure S4. Molecular functions derived from the GO annotation for differentially expressed genes. The X-axis indicates the correspondent number of genes.