-
Embryonic liver tissues were kindly provided by Zhongnan Hospital of Wuhan University with informed written consent from all participating family members. Ethical approval for the study was granted by the institutional bioethics committee of Wuhan Institute of Virology, Chinese Academy of Sciences (approval number WIVH24201101).
-
The lentiviral vectors (pWPI) and packaging plasmids (pCMV-dR8.91 and pMD.2G) were obtained from Addgene (http://www.addgene.org) and have been described elsewhere (Wiznerowicz and Trono, 2003). To construct pWPI-Puro, the puromycin-resistance gene was inserted to replace GFP. hNTCP (with the same coding sequence as previously reported) (Yan et al., 2012) was inserted into pWPI-Puro. Recombinant lentiviruses were produced as previously described (Wang et al., 2013). After 48 h, the culture medium was collected, and centrifuged to remove debris at 1000 × g for 10 min, followed by filtration through 0.45-μm cellulose acetate filters (Millipore, Billerica, Massachusetts, USA). Then, the filtered medium was centrifuged using Ultracel-100K centrifugal filters (Millipore). Finally, the concentrated lentivirus was stored at –80 °C ready for experiments.
-
Huh7DhNTCP cells were established by adding recombinant lentivirus to the culture medium in the presence of 6 μg/mL polybrene (Sigma, Shanghai, China). The medium was refreshed 12 h later, and 5~10 μg/mL puromycin (InvivoGen, San Diego, CA, USA) was added to the cells 48 h later to screen for positive cells.
Cell lines (293T, HepG2, Huh7, Huh7DhNTCP, and HepG2hNTCP) were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, Grand Island, USA) supplemented with 10% fetal bovine serum (Gibco), 100 U/mL penicillin, and 100 μg/mL streptomycin. Huh7D hNTCP cells were induced by 2.5% DMSO (Inducing medium: DMEM supplemented with 5% FBS, 100 U/mL penicillin, 100 μg/mL streptomycin) for 24 h before HBV infection, whereas HepG2hNTCP cells were maintained in PMM (2.5% DMSO) for 24 h before HBV infection, as described elsewhere (Yan et al., 2012).
-
HBV infectious particles were prepared from HepAD38 cells as previously described (Schulze et al., 2010). Concentrated HBV stocks diluted in PMM and supplemented with 4% (w/v) PEG8000 were added directly to susceptible cells. After a 24-h incubation, the cells were washed extensively three times with PBS, and the media were refreshed. Huh7DhNTCP cells were maintained in inducing medium, and HepG2hNTCP cells were maintained in PMM (2.5% DMSO). For the HBV binding and uptake assay, approximately 2 × 106 Huh7DhNTCP or HepG2hNTCP cells in each well of a 6-well plate were incubated with HBV in the presence of 4% PEG8000 at 4 °C for 24 h (HBV binding only), at 37 °C for 24 h (binding and uptake), or at 37 °C for 24 h but digested with trypsin for 10 min followed by washing twice with 1×PBS to remove bound HBV particles (uptake only). HBV DNA was extracted using a method described by Hirt (Hirt, 1967). Myrcludex B, the analogue of myr-preS12-47, was synthesized by GL Biochem Company (Shanghai, China) and used to specifically block HBV infection.
HCV J399EM (genotype 2a) was prepared and infected as previously reported (Han et al., 2009; Cao H. et al., 2014a). The HCV virion was added to susceptible cell lines at a multiplicity of infection (MOI) of 1, and chimeric HCV-GFP was recorded with a fluorescence microscope.
-
The culture media were collected at the indicated time points. The level of HBsAg or HBeAg was detected by enzyme-linked immunosorbent assay (ELISA) according to the manufacturer’s instructions (KHB, Shanghai, China). Each sample was measured in triplicate utilizing an Epoch Microplate Spectrophotometer (Bio-Tek, Winooski, USA), and the values are presented as the mean of OD450 – OD630 ± standard deviation. The cut-off value was calculated according to manufacturer’s instructions.
-
Total RNA was extracted from the cells, using TRIzol Reagent (Invitrogen, Carlsbad, USA) according to the manufacturer’s protocol. Real-time PCR was performed on an ABI QuantSudio 6 Flex device, using a QuantiTech SYBR Green RT-PCR Kit (Qiagen, Hilden, Germany). β-Actin was served as the internal control for sample normalization. The relative mRNAs level was calculated using the △△CT method. All samples were measured in triplicate, and all experiments were repeated independently three times. The primers used for real-time PCR are listed in Table 1.
Primers Sequence (5′–3′) hNTCP-F CTCAAATCCAAACGGCCACAATAC hNTCP-R CACACTGCACAAGAGAATGATGATC HNF4α-F GGCCAAGTACATCCCAGCTT HNF4α-R TCATTGCCTAGGAGCAGCAC Albumin-F ACTATCTATCCGTGGTCCTGA Albumin-R TCTTGATTTGTCTCTCCTTCT CYP 3A4-F TCCATTCCTCATCCCAATTCTTGA CYP 3A4-R TCCACTCGGTGCTTTTGTGT AFP-F CCAACAGGAGGCCATGCTT AFP-R GAATGCAGGAGGGACATATGTTT β-actin-F ATCGTGCGTGACATTAAGGAG β-actin-R GGAAGGAAGGCTGGAAGAGT Table 1. Primers used for real-time PCR
-
Western blot was performed as previously described (Zhou et al., 2014b). The primary antibodies used were rabbit anti-human hNTCP polyclonal antibody (Sigma: HPA042727) and mouse anti-human GAPDH monoclonal antibody (ProteintechTM, Chicago, USA).
-
An immunofluorescence assay was performed as described previously (Zhou et al., 2014b). The primary antibodies were rabbit anti-HBcAg polyclonal antibody (Dako, Glostrup, Denmark), mouse anti-HBsAg monoclonal antibody (Cao L. et al., 2014), mouse anti-CD81 antibody (Santa Cruz, California, USA), and rabbit anti-hNTCP polyclonal antibody (Sigma: HPA042727). The secondary antibodies were Alexa Fluor-488 or Alexa Fluor-568 conjugated (Life Technologies, Waltham, Massachusetts, USA). The nucleus was stained with DAPI (Roche, Basel, Switzerland). The stained cells were examined under a fluorescence microscope (Leica, Wetzlar, Germany) or confocal microscope (PerkinElmer, Massachusetts, USA).
-
HBV total DNA was extracted by a method described by Hirt (Hirt, 1967), and core-associated HBV DNA was extracted by a method described elsewhere (Wu et al., 2010). Southern blot was performed as described previously (Zhou et al., 2014a). Northern blot was performed as described elsewhere (Pei et al., 2014) using a Northern Max Kit (Life Technologies) according to the manufacturer’s instructions. Approximately 30 μg denaturized RNA per sample was loaded onto a 1.2% RNase-free agarose gel.
Productive HBV infection of well-differentiated, hNTCP-expressing human hepatoma-derived (Huh7) cells
- Received Date: 24 March 2017
- Accepted Date: 17 July 2017
- Published Date: 29 September 2017
Abstract: Feasible and effective cell models for hepatitis B virus (HBV) infection are required for investigating the complete lifecycle of this virus, including the early steps of viral entry. Resistance to dimethyl sulfoxide/polyethylene glycol (DMSO/PEG), hNTCP expression, and a differentiated state are the limiting factors for successful HBV infection models. In the present study, we used a hepatoma cell line (Huh7DhNTCP) to overcome these limiting factors so that it exhibits excellent susceptibility to HBV infection. To achieve this goal, different hepatoma cell lines were tested with 2.5% DMSO / 4% PEG8000, and one resistant cell line (Huh7D) was used to construct a stable hNTCP-expressing cell line (Huh7DhNTCP) using a recombinant lentivirus system. Then, the morphological characteristics and differentiation molecular markers of Huh7DhNTCP cells with or without DMSO treatment were characterized. Finally, the susceptibility of Huh7DhNTCP cells to HBV infection was assessed. Our results showed that Huh7D cells were resistant to 2.5% DMSO / 4% PEG8000, whereas the others were not. Huh7DhNTCP cells were established to express a high level of hNTCP compared to liver extracts, and Huh7DhNTCP cells rapidly transformed into a non-dividing, well-differentiated polarized phenotype under DMSO treatment. Huh7DhNTCP cells fully supported the entire lifecycle of HBV infection. This cell culture system will be useful for the analysis of host-virus interactions, which should facilitate the discovery of antiviral drugs and vaccines.