Citation: Nai-tong Yu, Tuan-cheng Feng, Yu-liang Zhang, Jian-hua Wang, Zhi-xin Liu. Bioinformatic Analysis of BBTV Satellite DNA in Hainan .VIROLOGICA SINICA, 2011, 26(4) : 279-284.  http://dx.doi.org/10.1007/s12250-011-3196-7

Bioinformatic Analysis of BBTV Satellite DNA in Hainan

cstr: 32224.14.s12250-011-3196-7
  • Corresponding author: Zhi-xin Liu, itbblzx@yahoo.com.cn
  • Received Date: 09 April 2011
    Accepted Date: 01 July 2011
    Available online: 01 August 2011

    Fund Project: The Central Level, Scientific Research Institutes for Basic R & D Special Fund Business ITBB110303

  • Banana bunchy top virus (BBTV), family Nanaviridae, genus Babuvirus, is a single stranded DNA virus (ssDNA) that causes banana bunchy top disease (BBTD) in banana plants. It is the most common and most destructive of all viruses in these plants and is widespread throughout the Asia-Pacific region. In this study we isolated, cloned and sequenced a BBTV sample from Hainan Island, China. The results from sequencing and bioinformatics analysis indicate this isolate represents a satellite DNA component with 12 DNA sequences motifs. We also predicted the physical and chemical properties, structure, signal peptide, phosphorylation, secondary structure, tertiary structure and functional domains of its encoding protein, and compare them with the corresponding quantities in the replication initiation protein of BBTV DNA1.

  • 加载中
    1. Bell K E, Dale J L, Ha C V, et al. 2002. Characterisation of Rep-encoding compenents associated with banana bunchy top nanovirus in Vietnam. Arch Virol, 147: 695-707.
        doi: 10.1007/s007050200019

    2. Burns T M, Harding R M, Dale J L. 1995. The genome organization of Banana bunchy top virus: analysis of six ssDNA components. J Gen Virol, 76: 1471-1482.
        doi: 10.1099/0022-1317-76-6-1471

    3. Dale J L. 1987. Banana bunchy top: aneconomically important tropical plant virus disease. Adv Virus Res, 33: 301-325.
        doi: 10.1016/S0065-3527(08)60321-8

    4. Fauquet C M, Mayo M A, Maniloff J, et al. 2005. Virus Taxonomy, Classification and Nomenclature of Viruses. In: Eighth Report of the International Committee on the Taxonomy of Viruses. Amsterdam, Boston, Heidelierg: Elsevier Academic Press.

    5. Harding R M, Burns T M, Dale J L. 1991. Virus-like particles associated with banana bunchy top disease contain small single-stranded DNA. J Gen Virol, 72:225-230.
        doi: 10.1099/0022-1317-72-2-225

    6. Harding R M, Burns T M, Hafner G J, et al. 1993. Nucleotide-sequence of one-component of the Banana bunchy top virus genome contains a putative replicase gene. J Gen Virol, 74: 323-328.
        doi: 10.1099/0022-1317-74-3-323

    7. Hermann S R, Becker D K, Harding R M, et al. 2001. Promoters derived from banana bunchy top virus-associated components S1 and S2 drive transgene expression in both tobacco and banana. Plant Cell Rep, 20: 642-646.
        doi: 10.1007/s002990100348

    8. Horser C L, Karan M, Harding R M, et al. 2001. Additional Rep-encoding DNAs associated with banana bunchy top virus. Arch Virol, 146: 71-86.
        doi: 10.1007/s007050170192

    9. Karan M, Harding R M, Dale J L. 1997. Association of banana bunchy top virus DNA components 2 to 6 with banana bunchy disease. Mol Plant Pathol, On-line: 1-16.

    10. Wu R Y, You L R, Soong T S. 1994. Nucleotide sequence of two circular single-stranded DNA's associated with banana bunchy top virus. Phytopathology, 84: 952–958.
        doi: 10.1094/Phyto-84-952

    11. Yu N T, Zhang Y L, Wang J H, et al. 2011. Characteristics analysis of banana bunchy top virus Rep protein and establishment of its purification system. J Agric Sci Technol, 13(2): 31-37.

    12. Zhou Z Z, Lin Q Y, Xie L H, et al. 1993. Studies on banana bunchy top I. Incidence, epidemics and distribution of the disease in Fujian. J Fujian Agric Univ (Nat Sci ed), 22(3): 305-310.

  • 加载中

Figures(4) / Tables(3)

Article Metrics

Article views(7974) PDF downloads(18) Cited by()

Related
Proportional views

    Bioinformatic Analysis of BBTV Satellite DNA in Hainan

      Corresponding author: Zhi-xin Liu, itbblzx@yahoo.com.cn
    • Institute of Tropical Bioscience and Biotechnology, CATAS, Haikou 571101, China
    Fund Project:  The Central Level, Scientific Research Institutes for Basic R & D Special Fund Business ITBB110303

    Abstract: Banana bunchy top virus (BBTV), family Nanaviridae, genus Babuvirus, is a single stranded DNA virus (ssDNA) that causes banana bunchy top disease (BBTD) in banana plants. It is the most common and most destructive of all viruses in these plants and is widespread throughout the Asia-Pacific region. In this study we isolated, cloned and sequenced a BBTV sample from Hainan Island, China. The results from sequencing and bioinformatics analysis indicate this isolate represents a satellite DNA component with 12 DNA sequences motifs. We also predicted the physical and chemical properties, structure, signal peptide, phosphorylation, secondary structure, tertiary structure and functional domains of its encoding protein, and compare them with the corresponding quantities in the replication initiation protein of BBTV DNA1.

    • Banana bunchy top virus (BBTV), family Nanaviridae, genus Babuvirus [4], is a single stranded DNA virus (ssDNA) that causes banana bunchy top disease (BBTD) in banana plants. It is the most common and most destructive of all viruses in these plants. Once it becomes established, it is extremely difficult to eradicate or contain. The virus is widespread throughout the Asia-Pacific region including Southeast Asia, the Philippines, Taiwan, most of the South Pacific islands, and parts of India and Africa. An infected plant does not bear fruit and, as a virus reservoir, has to be destroyed, thus an outbreak can have catastrophic effects on a plantation, leading to huge economic losses [3, 12].

      Viral mitochondria of BBTV are icosahedral particles about 18~20 nm in diameter [2], and the genome comprises of ssDNA components termed DNA1 to DNA6 each of ~1.0~1.1 kb [2, 5, 6, 9].

      The first of the satellite components were isolated in 1994 by Rey-Yuh et al and contained 4 putative coding regions, one of which encoded a replication initiation protein (Rep) [10]. In 2001, Horser found additional BBTV satellites DNA S1 and S2 with similar functions to BBTV DNA1 encoding Rep. However, the components of BBTV S1 and S2 differed from that of BBTV DNA1 in the CR-SL, internal gene, and TATA box. Most of these components were found in Asian isolates from Vietnam, Taiwan, Philippine, Tonga and Samoa [8]. Furthermore, Hermann reported promoter activation of S1 and S2 fusing to a -glucuronidase reporter gene. Transient assays indicated that both S1 and S2 derived promoters were active and had greater expression levels [7]. Satellite DNA was also discovered in the next year from a Vietnam isolate by Bell who named this component as DNA S3 [1].

      In this research, we performed further study of BBTV satellite DNA isolated in Hainan Island China. We cloned and sequenced the DNA and performed analysis of the DNA sequence. Although it is 17 years since the first satellite DNA component was isolated, it is still unclear why these elements exist, and why they are only present in some but not all isolates.

    • Pseudostems and leaves of banana were collected from Haikou City, Hainan Province, China, and stored at -80℃; E.coli Trans5α strain was purchased from TransGen Biotechnology Co. Ltd. (Beijing China); rTaq DNA polymerase, ampicillin and DNA Marker were purchased from TIANGEN Co. Ltd. (China); All other chemical reagents were of analytical grade and purchased locally.

    • Primers were predicted from the conserved regions of BBTV satellite DNA sequences downloaded from GenBank. The following two pairs of primers were designed: 7B1F (5'-ATCTGGGTCTATGGTCCGAATGG) / 7B1R (ATGCTTCGATCATCGGGTTCCTC), 7B2F (5'-GATGATCGAAGCATCATCTGGG)/7B2R(GGGT TCCTCGTTCAATTGCCT). These were synthesized by Sangon Biotech (Shanghai) Co. Ltd. (China).

    • The PCR reaction consisted of: 10×PCR Buffer (Mg2+ Free) 2.5 μL, 10 μmol/L of each primer 0.5μL, dNTP (2.5 mmol/L) 2 μL, 25 μmol/L MgCl20.5 μL, rTaq DNA Polymerase (5 U/μL) 0.25μL, total DNA (200 ng/μL) 0.5 μL, and H2O to make up volume to 25 μL. Amplification conditions were: 94℃ predenaturation for 1 min; 94℃ denaturation for 30 s, 50℃ annealing for 30 s (two reactions are the same), 72 ℃ extension for 1 min, both reaction with 35 cycles; and final extension at 72℃ for 10 min. PCR products were detected on 1.0% agarose gel electrophoresis and purified with a DNA extraction kit. The purified products were cloned into a pMD18-T cloning vector (TaKaRa, Dalian, China) and transformed into DH5α competent cells (Transgen, Beijing, China). The positive clones were identified by colony PCR with the universal primers, M13-47 and RV-M, and sequenced in both directions (Shanghai Invitrogen Biotechnology CO. Ltd. China). The sequences were analyzed by the BLAST program at NCBI to verify the original sequences of BBTV.

    • Prediction of ORFs in satellite DNA were analyzed by the " ORF finder" online software tool. The UTR and its motifs were identified using the Primer Premier 5.0 software.

    • All the bioinformatic analysis were carried out of using online software available on Expasy website (expasy.org/tools) at the Swiss Institute of Bio in formatics.

    • All nucleotide sequences were downloaded from GenBank in the analysis. Sequences were aligned using Clustalx 1.83 and MEGA version 4.0 software was to create an N-J phylogenetic trees with 1000 bootstraps.

    • Satellite DNA from banana plants infected with BBTV was amplified by PCR and identified by 1%agarose gel electrophoresis. The result showed two DNA bands at about 1.0 kbp (Fig. 1) with consistent the expected size.

      Figure 1.  Amplification of satellite DNA. M, Marker DL15000 (bp); 1, Satellite DNA amplified by 7B1F/7B1R; 2, Satellite DNA amplified by 7B2F/7B2R; N, Negative control.

    • We found a 238 nt UTR sequence within the 1093 nt of the full-length satellite DNA using the " ORF finder" online software (Fig. 2), and predicted 12 motifs by the Primer Premier 5.0 software (Table 1). These motifs are transcription regulation sites, ATF-CREB, CRE-ATE, E4TF1, IRF-IBP, NFY-CBF, and TATA box. E1A a cofactor for RAR beta, PU1 a lineage-specific transcription factor, archA and archB both global transcriptional regulation, bra a zinc finger transcription factor.

      Figure 2.  UTR Sequence of satellite DNA

      Table 1.  Analysis UTR of satellite DNA by Primer Premier 5.0 software

    • We compared satellite DNA translated protein sequence with DNA1 protein sequence [11] at the amino acid level (Table 2), and find difference in the number of amino acids, amino acid sequence and the stability coefficient between the two proteins.

      Table 2.  Prediction physical and chemical properties of proteins from satellite DNA and DNA1

    • We next used online software tools to study the structure and function of the Rep protein in the DNA1 and satellite DNA, (Table 3), we found the two proteins differed in terms of phosphorylation sites, hydrophobicity and composition of secondary structure [11].

      Table 3.  Bioinformatics analysis of Rep protein of satellite DNA

    • The online prediction of three-dimensional structure of Rep of satellite DNA using the SWISS-MODEL software package at the Expasy website, identified some similarities with the three-dimensional structure of the pcv2 protein of porcinecircovirus (Fig. 3), but the homology of amino acid sequences is only 12.88%.

      Figure 3.  Homology modeling of Rep protein tertiary structure. Three-dimensional structure of pcv2 protein of porcinecircovirus (PDB code:2hw0)

    • The satellite DNA component (ChiHQ616080) had the highest homology with TaiU12586, about 85.4%, also high homology with TaiFJ389724, TaiEU366175, Tail32166 and TaiBBU12587. It is interesting that the satellite DNA had a lower homology with its DNA1 counterpart (ChiHQ616074) than with other viruses such as CFDV, SCSV, MVDV and FBNYV EV1-93 (Fig. 4). However, all of these sequences have the same secondary structure in which the C-terminal belongs to the P-loop NTPase superfamily and the N-terminal is a member of the viral-Rep superfamily, which indicates a shared evolutionary history amongst these viruses.

      Figure 4.  N-J Phylogenetic tree of satellite DNA CFDV: Coconut foliar decay virus (NC_001465), SCSV: Subterranean clover stunt virus (U16731), FBNYV: faba bean necrotic yellows virus (AJ005968), MVDV: Milk vetch dwarf virus (AB000921), DNA1: BBTV Haikou 2 isolate (HQ616074), others are satellite DNA from different isolates (Three letter prefix indicates location; Vie – Vietnam, Tai -Taiwan).

    • We report the detailed experimental and bioinformatic analysis of a BBTV isolate from Hainan Island, China. Not all of the satellite components are present in BBTV isolates in Asian, but commonly found in many Asian samples.

      In this work we cloned and sequenced the isolates. For the structure analysis of the translated protein sequence, although Pfam HMM results indicated it is functionally similar with BBTV DNA1 Rep, the phylogenetic analysis indicates the two proteins are quite diverse at the amino acid level, only 31.99%. So we guess that the function of proteins are principally decided by three-dimensional structure rather than amino acids sequences.

      Based on the limited geographical distribution of satellite DNA, we propose these components are non-essential for the BBTV genome, but provide some complementary functionality given their similarity to the Rep-encoding region of DNA 1. It may be that these satellite components are characteristic of a subgroup of multi-component ssDNA viruses that have not yet been classified [8]. It is also possible that additional satellite DNA components exist in other BBTV strains in Asia and identification of these components may help to further clarify their function in this virus.

    Figure (4)  Table (3) Reference (12) Relative (20)

    目录

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return