Citation: Lin Xu, Fuqiang Zhang, Weihong Yang, Tinglei Jiang, Guanjun Lu, Biao He, Xingyu Li, Tingsong Hu, Gang Chen, Yun Feng, Yuzhen Zhang, Quanshui Fan, Jiang Feng, Hailin Zhang, Changchun Tu. Detection and characterization of diverse alpha-and betacoronaviruses from bats in China .VIROLOGICA SINICA, 2016, 31(1) : 69-77.  http://dx.doi.org/10.1007/s12250-016-3727-3

Detection and characterization of diverse alpha-and betacoronaviruses from bats in China

cstr: 32224.14.s12250-016-3727-3
  • Corresponding author: Changchun Tu, changchun_tu@hotmail.com, ORCID: 0000-0002-8134-7502
  • Received Date: 15 January 2016
    Accepted Date: 21 January 2016
    Published Date: 02 February 2016
    Available online: 01 February 2016
  • Bats have been implicated as important reservoir hosts of alpha- and betacoronaviruses. In this study, diverse coronaviruses (CoVs) were detected in 50 of 951 (positive rate 5.3%) intestinal specimens of eight bat species collected in four provinces and the Tibet Autonomous Region of China by pan-coronavirus RT-PCR screening. Based on 400-nt RNA-dependent RNA polymerase (RdRP) sequence analysis, eight belonged to genus Alphacoronavirus and 42 to Betacoronavirus. Among the 50 positive specimens, thirteen gave rise to CoV full-length RdRP gene amplification for further sequence comparison, of which three divergent sequences (two from a unreported province) were subjected to full genome sequencing. Two complete genomes of betacoronaviruses (JTMC15 and JPDB144) and one nearly-complete genome of alphacoronavirus (JTAC2) were sequenced and their genomic organization predicted. The present study has identified additional numbers of genetically diverse bat-borne coronaviruses with a wide distribution in China. Two new species of bat CoV, identified through sequence comparison and phylogenetic analysis, are proposed.

  • 加载中
  • VS12250-016-3727-3.pdf
    1. Baez-Santos YM, John SES, Mesecar AD. 2015. The SARS-coronavirus papain-like protease: Structure, function and inhibition by designed antiviral compounds. Anti Res, 115: 21-38.
        doi: 10.1016/j.antiviral.2014.12.015

    2. Chu DKW, Peiris JSM, Chen H, Guan Y and Poon LLM. 2008. Genomic characterizations of bat coronaviruses (1A, 1B and HKU8) and evidence for co-infections in Miniopterus bats. J Gen Virol, 89: 1282-1287.
        doi: 10.1099/vir.0.83605-0

    3. Falcon A, Vazquez-Moron S, Casas I, Aznar C, Ruiz G, Pozo F, Perez-Brena P, Juste J, Ibanez C, Garin I, Aihartza J, Echevarria JE. 2011. Detection of alpha and betacoronaviruses in multiple Iberian bat species. Arch Virol, 156: 1883-1890.
        doi: 10.1007/s00705-011-1057-1

    4. Gao F, Ou HY, Chen LL, Zheng WX, Zhang CT. 2003. Prediction of proteinase cleavage sites in polyproteins of coronaviruses and its applications in analyzing SARS-CoV genomes. FEBS Letters, 553: 451-456.
        doi: 10.1016/S0014-5793(03)01091-3

    5. Ge XY, Li JL, Yang XL, Chmura AA, Zhu GJ, Epstein JH, Mazet JK, Hu B, Zhang W, Peng C, Zhang YJ, Luo CM, Tan B, Wang N, Zhu Y, Crameri G, Zhang SY, Wang LF, Daszak P, Shi ZL. 2013. Isolation and characterization of a bat SARS-like coronavirus that uses the ACE2 receptor. Nature, 503: 535-538.
        doi: 10.1038/nature12711

    6. He B, Zhang YZ, Xu L, Yang WH, Yang FL, Feng Y, Xia LL, Zhou JH, Zhen WB, Feng Y, Guo HC, Zhang HL, Tu CC. 2014. Identification of diverse alphacoronaviruses and genomic characterization of a novel severe acute respiratory syndrome-like coronavirus from bats in China. J Virol, 88: 7070-7082.
        doi: 10.1128/JVI.00631-14

    7. Kim Y-J, Cho Y-J, Kim D-W, Yang J-S, Kim H, Park SH, Han YW, Yun M-R, Lee HS, Kim A-R, Heo DR, Kim JA, Kim SJ, Jung H-D, Kim N, Yoon S-H, Nam J-G, Kang HJ, Cheong H-M, Lee J-S, Chun J, Kim SS. 2015. Complete genome sequence of Middle East respiratory syndrome coronavirus KOR/KNIH/002_05_2015, isolated in South Korea. Genome Announc, 3: e00787-15.

    8. Lai MMC, Perlman S, Anderson LJ. 2007. Coronaviridae. In: Fields Virology, Knipe DM and Howley PM (eds). Philadelphia: Lippincott Williams & Wilkins, pp.1305-1335.

    9. Lau SKP, Poon RWS, Wong BHL, Wang M, Huang Y, Xu HF, Guo RT, Li KSM, Gao K, Chan KH, Zheng BJ, Woo PCY, Yuen KY. 2010. Coexistence of different genotypes in the same bat and serological characterization of Rousettus bat coronavirus HKU9 belonging to a novel Betacoronavirus subgroup. J Virol, 84:11385-11394.
        doi: 10.1128/JVI.01121-10

    10. Lau SKP, Woo PCY, Li KSM, Huang Y, Wang M, Lam CSF, Xu HF, Guo RT, Chan KH, Zheng BJ, Yuen KY. 2007. Complete genome sequence of bat coronavirus HKU2 from Chinese horseshoe bats revealed a much smaller spike gene with a different evolutionary lineage from the rest of the genome. Virology, 367: 428-439.
        doi: 10.1016/j.virol.2007.06.009

    11. Li WD, Shi ZL, Yu M, Ren WZ, Smith C, Epstein JH,Wang HZ, Crameri G, Hu ZH, Zhang HJ, Zhang JH, McEachern J, Field H, Dzszak P, Eaton BT, Zhang SY, Wang LF. 2005. Bats are natural reservoirs of SARS-like coronaviruses. Science, 310: 676-679.
        doi: 10.1126/science.1118391

    12. Lu G, Wang Q, Gao GF. 2015. Bat-to-human: spike features determining ‘host jump’ of coronaviruses SARS-CoV, MERS-CoV, and beyond. Trends Microbiol, 23: 468-478.
        doi: 10.1016/j.tim.2015.06.003

    13. Lu R, Wang Y, Wang W, Nie K, Zhao Y, Su J, Deng Y, Zhou W, Li Y, Wang H, Wang W, Ke C, Ma X, Wu G, Tan W. 2015. Complete genome sequence of Middle East respiratory syndrome coronavirus (MERS-CoV) from the first imported MERS-CoV case in China. Genome Announc, 3: e00818-15.

    14. Menachery VD, Yount Jr BL, Debbink K, Agnihothram S, Gralinski LE, Plante JA, Graham RL, Scobey T, Ge XY, Donaldson EF, Randell SH, Lanzavecchia A, Marasco WA, Shi ZL, Baric RS. 2015. A SARS-like cluster of circulating bat coronaviruses shows potential for human emergence. Nat Med, 21: 1508-1513.
        doi: 10.1038/nm.3985

    15. Moratelli R, Calisher CH. 2015. Bats and zoonotic viruses: can we confidently link bats with emerging deadly viruses? Mem Inst Oswaldo Cruz, Rio de Janeiro, 110: 1-22.
        doi: 10.1590/0074-02760151

    16. Neuman BW, Joseph JS, Saikatendu KS, Serrano P, Chatterjee A, Johnson MA, Liao L, Klaus JP, Yates III JR, Wuthrich K, Stevens RC, Buchmeier MJ, Kuhn P. 2008. Proteomics analysis unravels the functional repertoire of coronavirus nonstructural protein 3. J Virol, 82: 5279-5294.
        doi: 10.1128/JVI.02631-07

    17. Ren WZ, Qu XX, Li WD, Han ZG, Yu M, Zhou P, Zhang SY, Wang LF, Deng HK, Shi ZL. 2008. Difference in receptor usage between severe acute respiratory syndrome (SARS) coronavirus and SARS-like coronavirus of bat origin. J Virol, 82: 1899-1907.
        doi: 10.1128/JVI.01085-07

    18. Serrano P, Johnson MA, Chatterjee A, Neuman BW, Joseph JS, Buchmeier MJ, Kuhn P, Wuthrich K. 2009. Nuclear magnetic resonance structure of the nucleic acid-binding domain of severe acute respiratory syndrome coronavirus nonstructural protein 3. J Virol, 83: 12998-13008.
        doi: 10.1128/JVI.01253-09

    19. Sun M, Ma JL, Wang YN, Wang M, Song WC, Zhang W, Lu CP, Yao HC. 2015. Genomic and epidemiological characteristics provide new insights into the phylogeographical and spatiotemporal spread of porcine epidemic diarrhea virus in Asia. J Clin Microbiol, 53: 1484-1492.
        doi: 10.1128/JCM.02898-14

    20. Suzuki T, MurakamiS, Takahashi O, Kodera A, Masuda T, Itoh S, Miyazaki A, Ohashi S, Tsutsui T. 2015. Molecular characterization of pig epidemic diarrhoea viruses isolated in Japan from 2013 to 2014. Infect Genet Evol, 36: 363-368.
        doi: 10.1016/j.meegid.2015.10.017

    21. Tang XC, Zhang JX, Zhang SY, Wang P, Fan XH, Li lF, Li G, Dong BQ, Liu W, Cheung CL, Xu KM, Song WJ, Vijaykrishna D, Poon LLM, Peiris JSM, Smith GJD, Chen H and Guan Y. 2006. Prevalence and genetic diversity of coronaviruses in bats from China. J Virol, 80: 7481-7490.
        doi: 10.1128/JVI.00697-06

    22. Vlasova AN, MarthalerD, Wang Q, Culhane MR, Rossow KD, Rovira A, Collins J, Saif LJ. 2014. Distinct Characteristics and Complex Evolution of PEDV Strains, North America, May 2013-February 2014. Emerging Infect Dis, 20: 1620-1628.

    23. Wacharapluesadee S, Duengkae P, Rodpan A, Kaewpom T, Maneeorn P, Kanchanasaka B, Yingsakmongkon S, Sittidetboripat N, Chareesaen C, Khlangsap N, Pidthong A, Leadprathom K, Ghai S, Epstein JH, Daszak P, Olival KJ, Blair PJ, Callahan MV, Hemachudha T. 2015. Diversity of coronavirus in bats from Eastern Thailand. Virol J, 12: 57-63.
        doi: 10.1186/s12985-015-0289-1

    24. Wang H, Liang B, Feng J, Sheng LX, Zhang SY. 2003. Molecular phylogenetic of hipposiderids (Chiroptera: Hipposideridae) and rhinolophids (Chiroptera: Rhinolophidae) in China based on mitochondrial cytochrome b sequences. Folia Zool, 2: 259-268.

    25. Woo PCY, Lau SKP, Lam CSF, Lau CCY, Tsang AKL, Lau JHN, Bai R, Teng JLL, Tsang CCC, Wang M, Zheng BJ, Chan KH, YuenKY. 2012. Discovery of seven novel Mammalian and avian coronaviruses in the genus Deltacoronavirus supports bat coronaviruses as the gene source of Alphacoronavirus and Betacoronavirus and avian coronaviruses as the gene source of Gammacoronavirus and Deltacoronavirus. J Virol, 86: 3995-4008.
        doi: 10.1128/JVI.06540-11

    26. Woo PCY, Wang M, Lau SKP, Xu HF, Poon RWS, Guo RT, Wong BHL, Gao K, Tsoi HW, Huang Y, Li KSM, Lam CSF, Chan K, Zheng BJ, Yuen K. 2007. Comparative analysis of twelve genomes of three novel group 2c and group 2d coronaviruses reveals unique group and subgroup features. J Virol, 81: 1574-1585.
        doi: 10.1128/JVI.02182-06

    27. Yang L, Wu Z, Ren X, Yang F, He G, Zhang J, Dong J, Sun L, Zhu Y, Du J, Zhang S, Jin Q. 2011. Novel SARS-like betacoronaviruses in bats, China. 2013. Emerging Infect Dis, 19: 989–991.

    28. Yuan JF, Hon CC, LiY, Wang DM, Xu GL, Zhang HJ, Zhou P, Poon LLM, Lam TTY, Leung FCC, Shi ZL. 2010. Intraspecies diversity of SARS-like coronaviruses in Rhinolophus sinicus and its implications for the origin of SARS coronaviruses in humans. J Gen Virol, 91: 1058-1062.
        doi: 10.1099/vir.0.016378-0

  • 加载中

Figures(3) / Tables(6)

Article Metrics

Article views(8596) PDF downloads(42) Cited by()

Related
Proportional views

    Detection and characterization of diverse alpha-and betacoronaviruses from bats in China

      Corresponding author: Changchun Tu, changchun_tu@hotmail.com
    • 1. Military Veterinary Institute, Academy of Military Medical Sciences, Changchun 130122, China;
    • 2. Center for Disease Control and Prevention of Chengdu Military Region, Kunming 650118, China;
    • 3. Yunnan Institute of Endemic Diseases Control and Prevention, Dali 671000, China;
    • 4. School of Urban and Environmental Sciences, Northeast Normal University, Changchun 130024, China;
    • 5. Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou 225009, China

    Abstract: Bats have been implicated as important reservoir hosts of alpha- and betacoronaviruses. In this study, diverse coronaviruses (CoVs) were detected in 50 of 951 (positive rate 5.3%) intestinal specimens of eight bat species collected in four provinces and the Tibet Autonomous Region of China by pan-coronavirus RT-PCR screening. Based on 400-nt RNA-dependent RNA polymerase (RdRP) sequence analysis, eight belonged to genus Alphacoronavirus and 42 to Betacoronavirus. Among the 50 positive specimens, thirteen gave rise to CoV full-length RdRP gene amplification for further sequence comparison, of which three divergent sequences (two from a unreported province) were subjected to full genome sequencing. Two complete genomes of betacoronaviruses (JTMC15 and JPDB144) and one nearly-complete genome of alphacoronavirus (JTAC2) were sequenced and their genomic organization predicted. The present study has identified additional numbers of genetically diverse bat-borne coronaviruses with a wide distribution in China. Two new species of bat CoV, identified through sequence comparison and phylogenetic analysis, are proposed.

    • Coronaviruses(CoVs,family Coronaviridae,subfamily Coronavirinae)are important human and animal pathogens which,according to the latest release of Virus Taxonomy by the International Committee on Taxonomy of Viruses(ICTV,http://www.ictvonline.org/virusTaxonomy.asp?msl_id=26),currently comprise four distinct genera: Alphacoronavirus(αCoV),Betacoronavirus(βCoV),Gammacoronavirus(γCoV) and Deltacronavirus(δCoV). This large group of viruses has a wide spectrum of hosts,including humans,rodents,carnivores,chiropters and avians, and cause respiratory,enteric,hepatic and neurological diseases(Lai et al,2007). They include even public threats such as the severe acute respiratory syndrome(SARS) and the current Middle East respiratory syndrome(MERS)(Moratelli et al,2015). Bats are host animals of diverse αCoVs and βCoVs that may serve as the ancestral origins of mammalian CoVs(Falcon et al,2011; Woo et al,2012). In last decade,increasing numbers of bat CoVs with wide molecular diversities have been reported worldwide,particularly in China(Li et al,2005; Tang et al,2006; Woo et al,2007; Chu et al,2008; Yuan et al,2010; He et al,2014),some of which likely have the potential ability to cause human diseases(Ge et al,2013; He et al,2014; Menachery et al,2015). These findings indicate that further diverse CoVs circulate in bat populations. China has a nationwide distribution of about 120 bat species,with many roosting regions remaining uninvestigated for harbored mammal viruses. Here,we report a continuing investigation on bat-borne CoVs in some unexplored regions in China,the results of which have revealed more novel CoVs that circulate and evolve in bat populations with great molecular diversity and wide geographic distribution.

    • A total of 951 bats covering 5 families and 21 species were captured between 2005 and 2013,in Jilin,Liaoning,Yunnan,Guangdong provinces and the Tibet Autonomous Region,China. Bat species were morphologically identified by a trained field biologist and further confirmed by PCR of their mitochondrial cytochrome b gene sequence(Wang et al,2003). Respiratory and intestinal tissue specimens were collected separately from each bat and stored at –80 ℃ immediately until further processing.

    • Viral RNA of each specimen was extracted by using the RNeasy Mini Kit(Qiagen,Hilden,Germany), and was immediately reverse-transcribed with the Superscript Ⅲ Kit(Invitrogen,San Diego,CA)using r and om primers. Pan-CoV nested PCR primers were used to amplify a 440-nt sequence in the RNA-dependent RNA polymerase(RdRP)gene by our published methods(He et al. 2014)(see Supplementary Table S1 for primer information). Expected PCR amplicons were directly sequenced by the Sanger method in an ABI 3730 sequencer(Comate Bio,Changchun,China).

    • The complete RdRP genes of positive samples were amplified using LA Taq(TaKaRa,Dalian,China). Primers were designed based on RdRP gene sequences of representative αCoV and βCoV strains available in GenBank. Reactions were carried out with a touch-down PCR program: 94 ℃ for 3 min,then 10 temperature decrement cycles(94 ℃ for 30 s,58 ℃ minus 1 ℃ per cycle for 30 s,72 ℃ for 2 min),followed by 35 normal cycles(94 ℃ for 30 s,52 ℃ for 30 s,72 ℃ for 3 min), and a last extension of 72 ℃ for 10 min.

      To obtain the full genomes of the interesting specimens,overlapping amplicons were obtained by the above PCR program following by assembly into contigs. In addition,deep sequencing and genome walking were also undertaken to recover more genomic sequences. The 5′ and 3′ termini were sequenced using a 5′ Full RACE Kit with TAP and a 3′ Full RACE Core Set with PrimeScript RTase(TaKaRa,Dalian,China). Primer sequences for full-length genome amplification are shown in Supplementary Table S1.

    • Genomic structures of the CoV complete sequences were predicted by the SeqBuilder program of the DNAStar software package and compared with other representatives from GenBank. Nonstructural proteins(nsps)in ORF1a and ORF1b(replicase)of the CoVs were predicted using Z-Curve version 2.0,a CoV-specific gene-finding system(Gao et al,2003).

      All 400-bp amplicons(the primer truncation of 440-nt sequences)were aligned with their closest phylogenetic neighbors in GenBank using Clustal W version 2.0. The phylogenetic tree was then constructed by the maximum likelihood method of MEGA 6.06 with 1,000 bootstrap replications. To better underst and their evolutionary relationships,the complete RdRP genes were further amplified and used for the analysis.

    • The partial RdRP sequences obtained from all positive samples and the complete genome or full length RdRP sequences of some specimens were submitted to the GenBank under accession numbers KU182954 to KU183005.

    • Of 951 bats tested 50 intestinal specimens(5.3%)were CoV positive,but surprisingly all respiratory specimens showed negative amplification. As shown in Table 1,among 181 bats from 6 species in 3 families in Guangdong province,16.2%(6/37)Rousettus leschenaultia and 27.5%(14/51)Cynopterus sphinx were CoV positive. Among 599 bats from 17 species in 5 families in Yunnan province,14.0%(14/100)Rousettus leschenaulti,2.4%(1/41)Megaerops kusnotei,9.0%(7/78)Rhinolophus sinicus and 5.3%(5/95)Myotis daubentonii were CoV positive. As the first study of this kind in the Tibet Autonomous Region,fifteen Hipposideros cineraceus and five Rhinolophus hipposideros collected in south Tibet were tested and only 6.7%(1/15)Hipposideros cineraceus showed positive amplification. In northeast China,2 of 97(2.1%)bats in Jilin province were positive: one from Murina leucogaster and another from Rhinolophus ferrumequinum. In contrast,all 16 Rhinolophus ferrumequinum and 38 Myotis ricketti in Liaoning province showed negative amplification. These results revealed a higher CoV incidence in three fruit bat species of the family Pteropodidae than in the four insectivorous bat families,indicating that fruit bats are more likely to harbor CoVs.

      BatsGuangdong(Year 2005)Yunnan(Years 2012, 2013)Tibet(Year 2013)Liaoning(Year 2013)Jilin(Year 2013)
      FamilySpeciesBat CoV& BatCoVBatCoVBatCoVBatCoV
      PteropodidaeRousettus leschenaulti6/37(16.2)414/100(14.0)4
      Cynopterus sphinx14/51(27.5)4
      Megaerops kusnotei1/41(2.4)4
      HipposideridaeHipposideros cineraceus0/91/15(6.7)
      Hipposideros pomona0/84
      Hipposideros larvatus0/680/2
      Hipposideros armiger0/110/18
      Aselliscus stoliczkanus0/33
      RhinolophidaeRhinolophus ferrumequinum0/420/161/30(3.3)2
      Rhinolophus sinicus7/78(9.0), 2
      Rhinolophus pusillus0/50/6
      Rhinolophus affinis0/3
      Rhinolophus hipposideros0/370/5
      Rhinolophus macrotis
      VespertilionidaeMyotis daubentonii5/95(5.3)3
      Myotis laniger0/8
      Myotis chinensis0/3
      Myotis capaccinii 0/40
      Myotis ricketti0/380/27
      Miniopterus schreibersi0/8
      Murina leucogaster1/40(2.5)
      MegadermatidaeMegaderma lyra0/1
      Note: positive/total bats; numbers in brackets indicate the coronavirus positive percentage. & CoV, α: αCoV; β: unclassified βCoV; β2: βCoV lineage 2; β3: βCoV lineage 3; β4: βCoV lineage 4.

      Table 1.  Bat sample collection and coronavirus detection.

    • To describe the genetic relationships among the 50 sequences obtained in this study and previously known CoVs,400-nt RdRP sequences were obtained from the primer truncation of 440-nt sequences and phylogenetically analyzed. Results showed that 8 sequences grouped into 3 clusters within the genus αCoV(Figure 1A). YDB5C is the first reported bat-borne CoV(Hipposideros cineraceus)in Tibet and clustered closely with MLHJC4,a CoV from Rhinolophus sinicus in Yunnan,both sharing 94% nt identity with previously reported strain HKU2/GD/430/2006 from Guangdong(Lau et al,2007). JTAC2 identified in Murina leucogaster in Jilin province diverged considerably from known CoVs,showing the hig-hest nt identity of only 83% to bat-borne coronavirus Neixiang-14 and Neixiang-52 detected also in Murina leucogaster, and followed by 78% nt identity with some p and emic porcine epidemic diarrhea virus(PEDV)strains that have emerged recently in China,USA and Japan(Vlasova et al,2014; Sun et al,2015; Suzuki et al,2015). Five other αCoVs(MLHJC1,MLHJC6,MLHJC8,MLHJC22,MLHJC34)identified from Rhinolophus sinicus in Yunnan formed a new group with MLHJC8 being slightly more divergent,showing highest nt identities(75%–89%)with the previously reported BtCoV/860/2005(Tang et al,2006). The remaining 42 bat CoV sequences were classified as βCoV and fell into 5 clusters(Figure 1B). Twenty identified in Guangdong fell into lineage β4,which showed the geographical relationship and was further divided into two distinct clusters,one with 6 sequences sharing 99% highest nt identity with HKU9-10-1(Lau et al,2010),while another including 14 sequences sharing the closest relationship with BtCoV/BRT55630/H.lek/CK/Tha/05/2012 detected in Hipposideros lekaguli in Thail and (Wacharapluesadee et al,2015). The 21 βCoVs identified in Yunnan province exhibited considerable genetic diversity and were distributed among lineages β2,β3 and β4. Fifteen fell into β4 and further divided into 2 lineages,fourteen sequences showing closest relationship to previously reported BtCoV/BRT55629/H.lek/CK/Tha/05/2012(Wacharapluesadee et al,2015),while another(ML92C)grouped with the above Guangdong sequences. Five sequences detected from Myotis daubentonii clustered within lineage β3,sharing > 91% nt identities with previously reported HKU4-4 from Tylonycteris pachypus (Woo et al,2007). This group showed about 80% nt identity with MERS-CoVs recently identified in China(Lu et al,2015) and Korea(Kim et al,2015). The remaining Yunnan bat CoV sequence,MLHJC35,detected in Rhinolophus sinicus, and the only Jilin province sequence,JTMC15,identified in Rhinolophus ferrumequinum were clustered into β2 and showed highest nt identities to SARS-related bat-borne CoVs(SARSr-BatCoVs). MLHJC35 was 97% identical with SARSr-BatCoV Cp/Yunnan2011 previously isolated in Yunnan province(Yang et al,2011),while JTMC15 shared 99% identity with SARSr-BatCoV Rf1 found in Rhinolophus ferrumequinum, Hubei province(Li et al,2005).

      Figure 1.  The 400-nt RdRP gene fragment based phylogenetic analysis of 50 bat CoV sequences obtained in this study (8 sequences of αCoV in (A) and 42 sequences of βCoV in (B)) in comparison with other representative strains retrieved from GenBank. Fifty sequences of this study are marked by triangles (13 sequences with complete RdRP gene sequencing are marked by solid triangles). The scale bar indicates the estimated number of substitutions per 10 nucleotides.

      To obtain more precise analysis,representative specimens of the 8 phylogenetic clusters were subjected to full RdRP gene amplification. Complete RdRP sequences were obtained with 13 specimens belonging to 6 clusters comprised of 3 αCoVs and 10 βCoVs. Phylogenetic analysis based on the full RdRP gene sequences was highly consistent with Figure 1(Phylogenetic tree of the full RdRP gene sequences is not shown).

    • Full genomic sequencing was successful in 2 of the above 13 specimens: JTMC15 from Rhinolophus ferrumequinum, Jilin province, and JPDB144 from Myotis daubentonii, Yunnan province,with a nearly complete genome sequence obtained of JTAC2 from Murina leucogaster. The full genomes of JTMC15 and JPDB144(including complete terminal sequences of 5′ end and 3′- poly A) and near-complete genome of JTAC2 were 28,761 nt,30,321 nt and 25,719 nt in size respectively,with G+C contents of 38.1%,41.0% and 43.4%. It is proved that two proteinases,papain-like proteinase(PLPro )encoded by nsp3 gene and main proteinase(MPro )encoded by nsp5 gene in ORF1a of CoVs are able to cleave the complex of ORF1a and ORF1b(replicase)into 16 mature nonstructural proteins(nsps)(Neuman et al,2008). Our analysis of the nsps in ORF1ab revealed that all the three bat CoV genomic sequences contain 16 nsps(nsp1–nsp16)in ORF1ab,but the cleavage sites are different for nsp3 or nsp5 in different CoVs. The length of deduced amino acids of putative nsps,their first-last residue and position in replicase are shown in Supplementary Table S2.

      Base on the nearly complete genomic sequence obtained,JTAC2 possesses the same genome structure as PEDVs with 7 genes in the order: 5′-ORF1a,1b,spike(S),3a,envelope(E),membrane(M) and nudeocapsid(N)-3′(Figure 2A). JTAC2 showed the nearest relationship(87.9% in ORF1a and 92.8% in ORF1b)with Lushi MI bat CoV isolates Neixiang-14 and Neixiang-52,but the latter two have very limited sequences available for further analysis. The recent PEDV-1C isolated from a piglet with diarrhea and vomiting(Sun et al,2015)was therefore used for sequence comparison and genomic organization analysis,since it has been fully sequenced and shares high identity with JTAC2(Figure 1A and Supplementary Table S3). The aa identity comparison shown in Supplementary Table S3 suggests that JTAC2 is a novel αCoV.

      Figure 2.  Predicted genome organizations of JTAC2, JTMC15 and JPDB144. (A) Nonstructural proteins are represented by open boxes, structural proteins by filled boxes. Apostrophes in JTAC2 identify unsequenced regions. (B) Sequence comparison showing the ORF shift of gene 7b of JTMC15 caused by the discontinuous deletions (represented by dots), resulting in elimination of gene 8 as compared to other SARS- and SARSr-CoVs. Nucleotide position are determined referencing strain BJ01. Stop codons and start codons are in bold fonts. Hu: human SARS-CoV; Ci: civet SARS-CoV; Bt: Bat SARS-CoV.

      JTMC15 is a SARSr-BatCoV having the same genome organization as other SARSr-BatCoVs(e.g.,Rf1),but sequence deletions were observed in ORF1a and N, and between genes 7b8. A 579-nt deletion in ORF1a of JTMC15 was also observed in SARSr-BatCoV Rs672 from a Rhinolophus sinicus bat(Yuan et al,2010) and a human SARS-CoV ShanghaiQXC2 from the late phase of the 2003 epidemic(GenBank #AY463060). This 579-nt deletion results in a 193-aa deletion of nsp3 in ORF1a,from residues 1059 to 1251 in the nucleic acid-binding(NAB)domain(Serrano et al,2009). A second deletion in the N gene of JTMC15(1156–1158 nt,one residue Q368 )was also found in 3 SARSr-BatCoV strains,Rp/Shaanxi2011(Yang et al,2013),Rm1(Li et al,2005) and 279/2005(Tang et al,2006). Interestingly,four discontinuous deletions were identified in JTMC15 between genes 7b and 8,which is unique in JTMC15,resulting in an ORF shift and elimination of gene 8(Figure 2B). Similar to known CoVs,extensive S gene variations were also observed in JTMC15,resulting in low aa identities with other SARSr-BatCoV strains(the highest being 86.1% to Rf1)as compared with other gene fragments in the genome. Receptor-binding motif(RBM)is an extended loop that lies on the surface of the receptor binding domain(RBD)of the spike protein, and is the most important domain for SARSr-BatCoV to recognize its host receptor,angiotensin-converting enzyme 2(ACE2)(Ren et al,2008; Baez-Santos et al,2015). Further alignment of the deduced amino acid sequences of RBM(55 aa)showed a closer relationship of JTMC15 to SARSr-BatCoVs than to human or civet SARS-CoVs(Supplementary Figure S1). Taking the above altogether,as shown in Figure 2A and Table 2,there are 13 genes predicted in JTMC15: 5′-ORF1a, 1b,S,3a,3b,E,M,6,7a,7b,N,9a,9b-3′. Apart from gene 7b(83.0%) and S(86.1%)all ORFs of JTMC15 had high aa identities to Rf1,ranging from 94.4%(9b gene)to 99.1%(M gene),indicating that JTMC15 is a new variant within the SARSr-BatCoV Rf1 species.

      ORFJTMC15Rf1Rs672BJ01
      Length Length% identityLength% identityLength% identity
      1a4185437898.0419093.8438393.5
      1b2704270498.1270498.1270498.0
      S1236124186.1125581.9124176.7
      3a27427498.227492.027486.2
      3b11411497.411491.311490.4
      E767694.87696.17696.1
      M22122199.122198.222197.7
      6636396.96392.26389.1
      7a12212298.412293.512291.9
      7b524483.04484.94479.2
      8(8a) -122-121-39-
      -(8b)-----84-
      N42042198.142296.742296.2
      9a979794.99879.69879.6
      9b707094.47083.17084.5
      Note: # Abbreviation and accession numbers: Rf1, DQ412042; Rs672, FJ588686; BJ01, AY278488. Gene 8 in SARSr-CoVs is described as 8a and 8b in SARS-CoVs.

      Table 2.  Comparison of ORF amino acid identities of JTMC15 and other SARS- and SARSr- CoVs#

      For JPDB144,the genome organization is almost the same as HKU4-4,with 10 genes in the order: 5′-ORF1a,1b,S,3a,3b,3c,3d,E,M,N-3′(Figure 2A). However,two differences were observed in the nsp2 of JPDB144: a 12-nt insertion(residues 1143 to 1146 of 1a) and a 3-nt deletion(residue 1155 of 1a). Other JPDB144 ORFs were the same as HKU4-4 in length,sharing aa identities of between 88.8%(3c gene) and 98.8%(E gene); however,an aa sequence comparison of JPDB144 ORFs to those of HKU5 and MERS-CoV strains in the Betacoronavirus lineage 3 showed rather low similarities(Supplementary Table S4).

    • As shown in Figure 1,diverse αCoVs and βCoVs have been identified in the present study from different bats sampled at 25 locations in 4 provinces and the Tibet Autonomous Region,demonstrating the wide distribution of CoVs among a range of bat species. Of 8 αCoVs identified,YDB5C is the first bat-borne CoV identified in the Tibet and Himalayan area,detected in 1 of 15 Hipposideros cineraceus bats collected in Yadong county of Tibet,located at thesouthern edge of the Himalayas bordering on Bhutan and India. Another newly identified CoV,MLHJC4,was detected in Rhinolophus sinicus in Yunnan province,which phylogenetically clustered closely with YDB5C,both showing 94% nt identity to HKU2/GD/430/2006 identified in Guangdong(Lau et al,2007),indicating that this type of αCoV has a wide range of bat reservoirs and geo-distribution in south-west China and perhaps neighboring regions. In addition,six other αCoV sequences JTAC2,MLHJC2,MLHJC6,MLHJC8,MLHJC22 and MLHJC34,found in this study clustered as two novel CoV groups. Although not novel,the βCoVs identified here showed abundance in genetic and geographical diversities. It is interesting to note that SARSr- and MERS-like CoVs were identified,particularly JTMC15 isolated in Jilin province – the first SARSr-Bat CoV to be discovered in Northeast China.

      In consideration of bat species,sampling locations and CoVs diversities,four pathogen/host/environment situations can be proposed. First,a single bat species at one location(even a single cave)harboring different CoV species(e.g.,Rhinolophus sinicus collected at the same site in Menglian county,Yunnan province,harboring three CoV species: HKU2-like,SARSr- and new αCoVs). Sec-ond,a single bat species roosting at different locations harboring the same CoVs(e.g.,Rousettus leschenaulti collected in Mengla county(south Yunnan) and W and ing county(west Yunnan)harboring the same βCoVs). Third,multiple bat species sampled at the same site harboring the same CoVs(e.g.,Rousettus leschenaulti and Megaerops kusnotei sampled at the same location in W and ing county harboring the same βCoVs). Different bat species collected at different locations may even harbor the same CoVs: e.g.,a Hipposideros cineraceus in Yadong,Tibet and a Rhinolophus sinicus in Menglian,Yunnan harbored HKU2-like viruses, and another Rhinolophus sinicus in Menglian and a Rhinolophus ferrumequinum in Tonghua county,Jilin province,harbored SARSr CoVs. Altogether,the data provided further evidence for the wide distribution of CoVs among bat populations in China, and for the suggestion that different CoVs employ different bat species as reservoirs.

      The present study has identified genetically diverse bat-borne CoVs,which were detected from intestinal tissue specimens of different bat speices of wide geographic distribution. But we failed to detect any CoV sequence from the respiratory specimens that probably due to the low virus load in the lung or specific intestine-tropism of CoV in bats. Bats are considered the gene source of Alphacoronavirus and Betacoronavirus (Woo et al,2012),especially of pathogenic CoVs that cause public threats. In last decade,increasing number of CoVs have been identified in bats,in which the viral genes were presumably originated and evolved with high mutation and recombination rates(Woo et al,2007). It is apparent that large numbers of circulating CoVs remain unidentified, and are evolving worldwide within the bat population. Investigations in unexplored regions are therefore urgently needed to gain further insights into CoV diversity and evolutionary dynamics.

    • This work was supported by the Science and Technology Basic Work Program from the Ministry of Science and Technology of China (2013FY113600), NSFC-Yunnan Province Joint Fund (U1036601) and Military Medical Health (13CXZ024).

    • The authors declared that they have no conflict of interest. The whole study was approved by the Administrative Committee on Animal Welfare of the Institute of Military Veterinary, Academy of Military Medical Sciences, China (Laboratory Animal Care and Use Committee Authorization, permit number JSY-DW-2010-02). All institutional and national guidelines for the care and use of laboratory animals were followed.

    • CT conceived the study and LX carried it out with BH’s guidance. FZ, WY, TJ, GL, TH, GC, YF, YZ, QF, JF and HZ were responsible for field investigation and bat sampling. TJ and GL identified bat species morphologically. XL took part in samples screening and CoVs detection. LX wrote the paper, CT and BH then revised it. All authors read and approved the final manuscript.

      Supplementary figures/tables are available on the website of Virologica Sinica: www.virosin.org;link.springer.com/journal/12250.

    • PrimersPosition of first nucleotide (nt)Sequences (5′3′)
      Pan-coronavirus nested primers
      CoVOF14615ATGGGWTGGGAYTAYCCIAARTG
      CoVOR15200TGYTGIGARCAAAAYTCRTG
      CoVF14618GGITGGGAYTAYCCIAARTGYGA
      CoVR15035CCRTCATCWGAIARWATCATCAT
      JTMC15
      F32811GCGTGTAGAYAARGTGCTTAA
      R34799CCACGCTTRAGAAATTCAA
      F44648GTKTCAGTDTCWTCACCAGA
      R46919AATRCTTAACAAYAAYAGCCACAT
      F56806CACTWCCTACRACTATWGCTAAAAAT
      R58939GCAGARGTRGMAAARTCACTATACT
      F68827CCTGGHTTACCDGGTACTGT
      R611329CGYCTAGCAGCATCATCATA
      F1017350TGAGTGTYGTCAATGCTAGAC
      R1019665CTACYTTDGTGTAAACAGCATTATT
      F1221283GCTATACCATGCATGCTAACT
      R1222615CGAAAAAGARGTTGAGTTGTAG
      5OR252ATTGGCTGAAACGACACCACTTC
      5IR161GTCGATTAAAGCACTTGGCTCCA
      3OF27341GACATCCCAGAGTGGAGGAG
      3IF27448AGGTGTTGATGCCTCAGGCTAT
      JPDB144
      F11GATTTAAGWGAATAGCYTRGCTATC
      R11749GTVGTWCCAGAVAGWARTGC
      F21572GGTACTATGYACTTTRTKCCT
      R23846CWGCDATRCCACCRCCAT
      F33759GTKACHHTAGTHTTWGGTGA
      R35978ACTAATAGYATCACYGCCA
      F45940TAYWCTAATAGYTGCCTTG
      R48244ACATCAGAYTCCACACC
      F5796TGGCCAGGAAARTTTAGC
      R510071TCACTACCAGTYTCRCTGTA
      F69854TACTGATGGTAARCTKAATTGTAG
      R612438CATAGTTTGCATAGCACT
      F712559TCWATGTATAAGCAAGCACGT
      R714645GGATCWGCKGCATACATCAT
      F814556TATCTTGTGGTTATCACTAC
      R817048ATACCTCTCTTGATTCAC
      F916931CGYATWGAYTATAGTGATGCTG
      R918983ATCCCAMTCMACACGTTC
      F1018791TATGCCTGCTGGASTCATTC
      R1020854ATACTGRCACAATTGCATATATT
      F1120639CCTATTGAYTTAACWATGATTG
      R1122365GARWAGAGRTGAACRCCTTG
      F1222338GAGTGGTTYGGYATTACMCA
      R1224688GAAATAGCACCRAAAGTRTTAG
      F1324267GCWGATCCYGGYTATATGC
      R1326250CATAACGRTTKTGYYCGAAG
      F1426140ACTAAAGYATYAGCAAAACAAGA
      R1427969CGTTAAACCCASTCSTCAG
      F1527842GCTAYTMGATTATGTGTGC
      R1530232GCCTAATCTAATTGAATAATAGC
      5OR268GTCACACTAGCCTTGGAAAGCA
      5IR83CAGACCACAACACAACACGCACACAACA
      3OF30061ATCATGTTARACTTACAGTGCAAG
      3IF30151AAAGACTGTCACCTCTGCGTGATT
      JTAC2
      F14010CCACTATGTSACCAATWTYTATGAT
      R16107CTTATCAATAAGCTTAGTAGCGTCT
      F25961TGTYGGMCAYTATACTGTTTTTGA
      R28460ACACGGCAATARGTCATAGC
      F38172TGGTAAAACWCTTGTKTTTGC
      R39704ACAAGCGCCATTAATGAA
      F49615TTAAYATTYTGGCRTGCTATGAT
      R411457CYTGTTCMGCCATTCTATCAA
      F511364GTTCTCCACCTCAGTTGGT
      R513349TCCTCACCAAAWATATCACTCTT
      F613199GATAAYCAGGATCTTAATGGTGA
      R615458TGACATGRTCATAAGCRCACTT
      F715309ATTCWACTGCTAARTTTTGGGA
      R717318CCATAAASGAKATWACATGCTCATA
      F817174GAKGGTTGYGGTCTYTTTAAAG
      R818608GGTGTTGTARGCATTARCATAGC
      F918470TGCCMTTYTTYTTCTATGATG
      R920451TCRAGCACACTRTTGTAAGACATAG
      F1020301GGACAATGTTYTGTACCAGTG
      R1022672ACATTCTTRAAGGCKARCAACTG
      F1122567AAYGTGTGCACCCAGTATACTAT
      R1124958TGAMGCTTTAAACAGTGCAA
      F1224352ATCCCAGAKTATGTYGATGTTAA
      R1226127ACCTTATAGCCYTCKACAAGCA
      F1325921CAGCATCCTTATGGCTTG
      R1327429ACTTTGGCACAGTCATYTTATAG
      Genome walking
      R14161TGGCTGTAAAGTTGGCTGAGGT
      R24274GCCACCACCATGAGACAAATTCT
      R34368CAGAGCCAACCTTAAGTTTGCCA
      R42642ACTTACARCTAACACCGGCCAGT
      R52745TAGTCAAACCGTTCTCTACWGGAAT
      R62889CGTCATAGAATGCATAACCATCAAC

      Table 1.  Primers used in this study

      nspJTAC2$ JTMC15JPDB144
      Length (aa)First - last residuePosition Length (aa)First - last residuePosition Length (aa)First - last residuePosition
      1--179M1 -G179 731M1 -G731
      2467Y1 -G467 639G180 -G818 489R732 -G1220
      3 (ADRP/PLPro )1637G468 -A2104 1724A819 -G2542 1572G1221 -A2792
      4480G2105 -Q2584 500K2543 -Q3042 512T2793 -Q3304
      5 (3CLPro )302S2585 -Q2886 306S3043 -Q3348 306S3305 -Q3610
      6276S2887 -Q3162 290G3349 -Q3638 292S3611 -Q3902
      783S3163 -Q3245 83S3639 -Q3721 83S3903 -Q3985
      8195T3246 -Q3440 198A3722 -Q3919 199A3986 -Q4184
      9108N3441 -Q3548 113N3920 -Q4032 110N4185 -Q4294
      10135A3549 -Q3683 139A4033 -Q4171 139A4295 -Q4433
      1117S3684 -D3700 13S4172 -V4184 14S4434 -V4447
      12 (RdRP)927S3684 -Q4610 932S4172- Q5103 934S4434 -Q5367
      13 (Hel)597S4611 -Q5207 601A5104 -Q5704 598A5368- Q5965
      14 (ExoN)517A5208 -Q5724 527A5705 -Q6231 523S5966 -Q6488
      15 (XendoU)339N5725 -Q6063 346S6232 -Q6577 342G6489 -Q6830
      16 (2-O-MT)301S6064 -K6364 298A6578 -N6875 302A6831 -L7132
      Note: $ The nsp2 of JTAC2 was partial sequence, lacking the 5’ terminal.

      Table 2.  Putative nonstructural proteins (nsps) of ORF1a and ORF1b (replicase) in BatCoV JTAC2, JTMC15 and JPDB144.

      ORFJTAC2Neixiang-14512PEDV
      LengthLength% identityLength% identityLength% identity
      1a3700 203087.9412868.9411776.4
      1b2680267992.8268185.3268088.8
      S1365--137158.6138657.1
      3a224--22456.922463.1
      E76--7683.17683.1
      M226--22779.722684.6
      N307 --39462.644158.8
      Note: # Abbreviation and accession numbers: Neixiang-14: MIBtCoV Neixiang-14, KF294377; 512: BatCoV/512/2005, NC_009657; PEDV: PEDV-1C, KM609203. § incomplete sequences.

      Table 3.  Comparison of ORF amino acid identities of JTAC2 with other three representative Alphacoronavirus strains#

      ORF JPDB144HKU4HKU5MERS
      LengthLength% identityLength% identityLength% identity
      1a4447444593.8448171.1439164.7
      1b2699269997.7271589.4270187.4
      S1352135294.5135269.6135367.1
      3a (3)919189.312144.810346.8
      3b (4a)11911992.511953.010938.3
      3c (4b)28528588.825639.224627.8
      3d (5)22722793.022346.622446.9
      E828298.88280.78269.9
      M21921997.322082.321984.2
      N42342397.942774.441370.8
      Note: # Abbreviation and accession numbers: HKU4: BatCoV HKU4-4, EF065508; HKU5: BatCoV HKU5-1, EF065509; MERS: MERS-CoV ChinaGD01, KT006149. § ORF3a, 3b, 3c, 3d in HKU4 and HKU5 are described in MERS-CoV as ORF3, 4a, 4b and 5 respectively.

      Table 4.  Comparison of ORF amino acid identities of JPDB144 with other two representative strains of Betacoronavirus lineage 3 (β3)# .

      Figure 1.  Amino acid sequences comparison of entire RBM of JTMC15, MLHJC35 (marked by asterisks) with other SARS or SARS-related coronaviruses. Middle letters: Hu: human SARS-CoV; Ci: civet SARS-CoV; Bt: Bat SARS-CoV.

    Figure (3)  Table (6) Reference (28) Relative (20)

    目录

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return