HTML
-
The fgf gene of HearNPV encodes a ~40-kDa protein containing 302 amino acids and six predicted N-linked glycans (Figure 1A). An early-transcription-initiation motif, TATATAA, followed by CAGT (18 nt downstream from TATA), was found 54 nt upstream of the ATG translation start codon of vfgf (Figure 1A), suggesting that vfgf is an early gene. In fact, we detected vfgf transcripts (575 bp) by reverse transcription (RT)-PCR analysis at 3 h.p.i. (Figure 1B), and western blot analysis indicated a protein band with the expected size of vFGF (~40 kDa) at 16 h.p.i. (Figure 1C). Given that HearNPV genomic DNA replication begins at ~14 h.p.i. (Dai et al., 2006), vfgf was suggested to be an early gene of HearNPV, with its expression continuing into the later stages of infection.
-
To determine vfgf function in HearNPV infectivity, the vfgf gene from bHaBacHZ8 was inactivated by homologous recombination and replaced by an egfp-cat cassette, with the resulting bacmid designated as bHaBac-Δvfgf-egfp (Figure 2A). Two recombinant bacmids were constructed based on bHaBac-Δvfgf-egfp: a vfgf-knockout bacmid (bHaBac-Δvfgf-egfp-ph), where the ph gene was re-inserted into the ph locus; and a vfgf-repaired bacmid (bHaBac-REPvfgf-egfp-ph), where the ph gene and vfgf under the control of its own promoter were inserted into the ph locus (Figure 2A). A previously constructed bacmid (bHaBac-egfp-ph) containing egfp and ph was used as a positive control (Luo et al., 2011). Using a transfection-infection assay, the effect of vfgf deletion on BV propagation was monitored by fluorescence microscopy (Figure 2B). Infection was observed in cells incubated with bHaBac-Δvfgf-egfp-ph-transfected cell supernatant, indicating that vfgf is nonessential for in vitro viral replication and infection (Figure 2B-a and B-d). Transfection-infection of the vfgf-repaired bacmid and the positive-control bacmid revealed results similar to those observed with bHaBac-REPvfgf-egfp-ph (Figure 2B-b, c, e and f).
The absence of vFGF in HaBac-Δvfgf-egfp-ph BVs was confirmed by western blot analysis. With anti-vFGF antiserum, no specific band was detected in BV samples harvested from the supernatant of vHaBac-Δvfgf-egfp-ph-infected HzAM1 cells. In contrast, a band of ~40 kDa was clearly detected in BV samples from vHaBac-REPvfgf-egfp-ph-and vHaBac-egfp-ph-infected cells (Figure 2C). The expression of VP39 indicated that similar BV concentrations were loaded into each lane (Figure 2C). These results confirmed the correct construction of all of the recombinants.
-
To study the effect of vfgf on infectious BV production, one-step growth curves were determined and compared. HzAM1 cells were infected with vHaBac-Δvfgf-egfp-ph, vHaBac-REPvfgf-egfp-ph, or vHaBac-egfp-ph in parallel (MOI=10). Supernatants collected at different post-infection time points were titrated by EPDA. The results showed that vHaBac-Δvfgf-egfp-ph, vHaBac-REPvfgf-egfp-ph, and vHaBac-egfp-ph exhibited similar kinetics of infectious BV production (Figure 3A). Statistical analysis also revealed that there was no significant difference between vfgf-knockout and -repaired viruses or with the control virus at all infection time points (P > 0.05).
Figure 3. Effect of vFGF on viral growth kinetics and DNA replication. (A) One-step growth-curve analysis of BV production. HzAM1 cells were infected with either vHaBac-Δvfgf-egfp-ph, vHaBac-REPvfgf-egfp-ph, or vHaBac-egfp-ph at an MOI of 10. BVs were harvested at the indicated post-infection time points and titrated onto HzAM1 cells. Each data point represents the average titer from three independent infections, and error bars represent standard deviations. (B) Real-time PCR analysis of viral DNA replication. HzAM1 cells were infected with the respective virus at an MOI of 10. At the indicated post-infection time points, total cellular DNA was isolated, digested with Dpn I, and subjected to real-time PCR analysis. The experiments were performed in triplicate, and error bars represent standard deviations. TCID50, 50% tissue-culture infection dose.
To further illustrate the effect of vfgf deletion on viral DNA synthesis, the level of viral DNA replication during infection was monitored by real-time PCR analysis. The results indicated that there was no significant difference in viral DNA copy number between vHaBac-Δvfgf-egfp-ph-and vHaBac-egfp-ph-infected cells at both 24 and 48 h.p.i. (P > 0.05; Figure 3B). These results indicated that vfgf deletion had no significant influence on either infectious BV production or viral DNA replication in cultured cells.
-
To determine the LD50 value of vHaBac-Δvfgf-egfp-ph, vHaBac-REPvfgf-egfp-ph, and vHaBac-egfp-ph, third-instar H. armigera larvae were infected orally with various doses of OBs and monitored for mortality. The LD50 value of vHaBac-Δvfgf-egfp-ph was 16.9 (12.4, 22.7) ×103 OBs, which was significantly higher than that of vHaBac-REPvfgf-egfp-ph or vHaBac-egfp-ph (P < 0.05), while no significant difference was observed between the LD50 values of vHaBac-REPvfgf-egfp-ph or vHaBac-egfp-ph (P > 0.05) (Table 1). We also compared the time required to kill infected larvae, with the results indicating that the ST50 value of vHaBac-Δvfgf-egfp-ph (~107 h) was significantly higher than that of vHaBac-egfp-ph (~95 h; P < 0.05), while no significant difference was observed between the ST50 values of vHaBac-REPvfgf-egfp-ph or vHaBac-egfp-ph (P > 0.05). These data indicated that vfgf deletion resulted in a delayed time of death of larvae infected orally (Table 2). Taken together, these results suggested that vfgf deletion significantly reduced HearNPV infectivity in larvae.
Viruses LD50×103 OBs (95% CI) Potency ratioa (95% CI) vHaBac-egfp-ph 9.2 (6.7, 12.5) - vHaBac-Δvfgf-egfp-ph 16.9 (12.4, 22.7) 1.8* (1.2, 2.9) vHaBac-REPvfgf-egfp-ph 8.7 (6.4, 12.0) 0.9 (0.6, 1.5) Note: a Potency ratio was calculated by dividing the LD50 of the vfgf-deleted or -repaired variants by that of vHaBac-egfp-ph. * Indicates significant difference based on the 95% CI of the potency ratio, including the value 1.0 (Robertson et al., 2007). CI, confidence interval. Table 1. Dose-mortality responses of vHaBac-egfp-ph, vHaBac-Δvfgf-egfp-ph, and vHaBac-REPvfgf-egfp-ph in third-instar H. armigera larvae
Tests Viruses ST50 (95% CI) (h) χ2 P 1 vHaBac-egfp-ph 95 (93.2, 96.7) - - vHaBac-Δvfgf-egfp-ph 107.5 (103.1, 111.9) 27.834 1×10-6 * vHaBac-REPvfgf-egfp-ph 94.5 (93.1, 95.9) 3.568 0.059 2 vHaBac-egfp-ph 95 (93.1, 96.9) - - vHaBac-Δvfgf-egfp-ph 107.5 (104.5, 110.5) 19.915 8×10-6* vHaBac-REPvfgf-egfp-ph 94.5 (93.6, 95.4) 3.327 0.068 Note: * Indicates significant difference between the vfgf-deleted variant and vHaBac-egfp-ph based on log-rank test. CI, confidence interval. Table 2. Time-mortality responses of vHaBac-egfp-ph, vHaBac-Δvfgf-egfp-ph, and vHaBac-REPvfgf-egfp-ph in third-instar H. armigera larvae.
Transcription and expression analysis of HearNPV vFGF
Construction and verification of vfgf-deleted and -repaired HearNPVs
The effect of vfgf deletion on infectious BV production and viral DNA replication in vitro
The contribution of vFGF to viral infectivity in infected insects
-
Primer Primer sequence (5′-3′) anti-vFGF-f GCGGGATCCAGACCGGGCGGACGAAAC anti-vFGF-r GCGAAGCTTCATGTACGTTACAACAACAG vFGF trans-f CGTGCCGTTATATTTGCGTTAACCAATGC vFGF trans-r CAGAGGTAACATGGATGATGTCTGTGG del-F1f CGGGGTACCATACAAATTCAACCTGCGAACTC del-F1r CCGCTCGAGATCATCCATGTTACCTCTGAC del-F2f CCGGATATCGTGCGAGTCAGTAGAATTTGTT del-F2r CTAGTCTAGAATTTCTAACACATTCTATGCGATTG vfgf-f GCGCTCGAGTGGAGCAGATTCAAGATTCGCC vfgf-r GCGGGTACCCATGTACGTTACAACAACAG Table S1. Sequences of primers used for PCR amplification