HTML
-
The H. zea ovarian cell line HzAM1 (McIntosh and Grasela 1994) was maintained at 28 ℃ in Grace's medium (Gibco-BRL) enriched with 10% fetal bovine serum. H. armigera larvae were raised on an artificial diet at 27 ℃. The bacmids, HaBacΔpif1-ph, HaBacΔpif2-ph and HaBacΔpif3-ph (ph stands for polyhedrin gene), constructed previously (Song et al. 2008), were used as the platform to construct pseudotyped viruses. An infectious HearNPV bacmid HaBacHZ8 (Wang et al. 2003), as well as a positive control virus HaBac-egfp-ph, were previously constructed in our laboratory (Song et al. 2008). HearNPVG4 and MabrNPV-CTa strains were maintained as laboratory stocks.
-
A schematic representation of the constructs is depicted in Fig. 1, the promoter regions (~ 200 bp 5' upstream) of Hapif1, Hapif2 or Hapif3 open reading frames were amplified from genomic DNA of HearNPV-G4 by specific primers (Supplementary Table S1). The PCR products were first cloned into the transfer vector pFB-DUAL-ph (Song et al. 2008) and the verified vectors were designated pFB-DUAL-pHapif(s)-ph. The coding sequences of pif1, pif2 or pif3 of MabrNPV were amplified from genomic DNA of MabrNPV-CTa by specific primers (Supplementary Table S1). A FLAG tag coding sequence (GACTACAAGGACGACGATGACAAG) was added to the 30 end of each MabrNPV pifs during amplification to facilitate protein detection. The resulting amplicons were cloned into the transfer vector pFB-DUAL-pHapif(s)-ph and authenticated by restriction enzyme digestion and sequencing. The transfer vectors were designated pFB-DUAL-pHapif(s)-Mbpif(s)-ph. Transposition into the respective pif-deleted HearNPV bacmids was carried out as outlined in the Bacto-Bac manual (Bac-to-Bac®Baculovirus expression System; InvitrogenTM Life Technologies, Carlsbad, USA). The constructed bacmids were examined by PCR and labelled as HaBacΔpif1-Mbpif1, HaBacΔpif2-Mbpif2 and HaBacΔpif3-Mbpif3.
Table Supplementary Table S1. Primers used in this study
Figure 1. Construction and identification of recombinant pif-replaced HearNPV bacmids. EGFP and chloramphenicol resistance coding sequences were inserted within pif loci. Hapif promoters and mbpif coding regions were respectively sequentially inserted in conjunction with ph coding region into the ph locus within the HaBacΔpifs bacmid. Upon examination and identification of the constructed bacmids, they were labelled as HaBacΔpif1-Mbpif1, HaBacΔpif2-Mbpif2 and HaBacΔpif3-Mbpif3.
-
To produce the recombinant viruses, HzAM1 cells were seeded into tissue culture dishes at a density of 1 × 106 cells per dish. Transfection was performed with 0.3 μg recombinant bacmid DNA using 10 μL lipofectin (Invitrogen). Fluorescent microscopy was used to determine transfection efficiency at 96 h post transfection (h.p.t). Supernatants with progeny viruses were clarified at 860 × g at 4 ℃ and used to infect a fresh batch of HzAM1 cells. The titers of the viruses were determined by end-point dilution assays (EPDAs).
-
Single step growth curves were determined when HzAM1 cells were infected with viruses at 5 multiplicity of infection (MOI, in TCID50 units/cell), and supernatants were collected at 0, 24, 48, 72 and 96 h post infection (h.p.i.) for EPDA. The assays were done in triplicates. Average titers for the time points, 24, 48, 72 and 96 h.p.i., for each virus were plotted in Graphpad Prism 5 and statistically analysed by IBM SSPS version 20. To determine replication in larvae, systemic larval infection was initiated by administering BVs into the haemolymph of late third-instar H. armigera larvae as described previously (Song et al. 2008). A 10 μL aliquot containing BVs adjusted to 5 × 106 TCID50 units/mL was injected intrahaemocoelically. At 96 h.p.i., the hemolymph, tracheal, midgut lumen, fat body and malphigian tubular tissues were extracted by dissection of injected larvae. These larval tissues were then examined by fluorescent microscopy. Grace's medium was used as a negative control and 120 larvae were used for each recombinant virus.
-
Larval cadavers containing recombinant virus OBs were homogenised in 0.5% SDS (1 mL per cadaver) and filtered through a double layer of cotton cheese cloth to remove large debris. The filtrate was centrifuged at 50× g for 5 min at 4 ℃ to remove further debris and the OBs in the supernatant fluid were pelleted at 3000× g for 5 min at 4 ℃. The pellet was washed three times with 0.1% SDS by centrifugation and finally the pellet was resuspended in deionised distilled water (ddH2O) and counted on a haemocytometer. For scanning electron microscopy (SEM), 10 μL OB suspension of recombinant HearNPVs or control virus HaBac-egfp-ph at 1 × 107 OBs/mL were dropped on an aluminium foil, left to dry at room temperature and prepared for imaging by gold spray. SEM micrographs were taken using a 100 kV Hitachi H-7000FA microscope. In transmission electron microscopy (TEM), 1 mL of OB was fixed with formaldehyde and prepared for imaging as described previously (Song et al. 2008) using a 200 kV FEI Tecnai G220 TWIN microscope.
-
HzAM1 cells were infected with HaBac-egfp-ph, HaBacΔpif1-Mbpif1, HaBacΔpif2-Mbpif2 and HaBacD pif3-Mbpif3 viruses at an MOI of 5 then harvested at 72 h post infection (h.p.i.) and centrifuged at 3000× g for 5 min at 4 ℃. To detect HaPIFs, infected cell pellets were resuspended in Laemmli sample buffer, heated in boiling water for 10 min and centrifuged at 10, 000× g for 1 min. To detect FLAG tagged MbPIFs, OBs were extracted from infected cells at 6 days post infection. The OBs were dissolved in DAS solution (0.1 mol/L Na2CO3, 166 mmol/L NaCl and 10 mmol/L EDTA, pH 10.5). An equal volume of 2 9 Laemmli sample buffer was added to the dissolved OB solution and heated in boiling water for 10 min and centrifuged at 10, 000× g for 1 min. Denatured protein samples were separated on 12% SDS-PAGE and analyzed by Western blots. Rabbit anti-HaPIFs-specific polyclonal antiserum (Song et al. 2008) and mouse anti-FLAG monoclonal antibodies (Invitrogen) were used as the primary antibodies to detect HaPIFs and MbPIFs, respectively. Horseradish peroxidase-conjugated goat anti-rabbit and anti-mouse immunoglobulins (Sigma Aldrich, St Louis, USA) were used as secondary antibodies. The final signal was generated by exposure to a chemiluminescent substrate kit (Super SignalTM West Pico Chemiluminescent substrate; Thermo Scientific, Rockford, USA) and detected by DNR Imaging System (Microchemi 2.0).
-
Oral infectivity of the recombinant viruses on third instar larvae was determined by droplet method as previously described (Song et al. 2008) with 10 μL of virus suspended in ddH2O adjusted to 3 × 108 OBs/mL (Sparks et al. 2008). Larvae were examined daily until they either died or pupated. The feeding assay was repeated twice. Since only HaBacΔpif3-Mbpif3 retained a certain level of oral infectivity, OBs of HaBacΔpif3-Mbpif3 were harvested and purified and used to conduct a bioassay at the following virus concentrations: 1 × 106, 3 × 106, 1 × 107, 3 × 107 and 1 × 108 OBs/mL. OBs of HaBac-egfp-ph were also used as a control at concentrations of 1 × 103, 3 × 103, 1 × 104, 3 × 104 and 1 × 105 OBs/mL. In all the above assays, individual larvae were added to one well of 24-well plates. At least 48 larvae in both assays were used per virus concentration and only larvae that had consumed all the virus contaminated food were considered for survival or death count.
-
The presence and absence of PIF complex of the recombinant viruses were detected by differentially denaturing SDS-PAGE and Western blot according to (Peng et al. 2010a) with slight modifications. Briefly, HaBac-egfp-ph, HaBacΔpif1-Mbpif1, HaBacΔpif2-Mbpif2 and HaBacD pif3-Mbpif3, were each used to infect 1 × 108 HzAM1 cells at 5 MOI and their OBs were extracted from infected cells at 7 d.p.i.. ODVs were released from the OBs by treatment with DAS solution (0.1 mol/L Na2CO3, 166 mmol/L NaCl and 10 mmol/LEDTA, pH 10.5), and centrifuged at 20, 000× g for 30 min at 4 ℃. The ODV containing pellet was resuspended in Laemmli buffer and heat treated either at 50 or 95 ℃ for 5 min prior to loading to SDS-PAGE gel and Western blot analyses. Total ODVs extracted from 1 × 107 OBs were loaded to each lane of the PAGE gel.
Insects, Cells and Viruses
Construction of Pifs-Replaced HearNPV Bacmids
Transfection and Infection
Virus Growth in Cell Culture and Larvae
Electron Microscopy (EM)
Western Blot Analyses of Recombinant Viruses
Feeding Assays
Detection of PIF Complex
-
HearNPV bacmids with pif deletions and carrying egfp marker (Song et al. 2008) were used as templates to insert MabrNPV pif homologs. In addition, 200 bp promoter regions of HearNPV pifs were inserted to control the expression of the MabrNPV pif homologs (Fig. 1). The recombinant HearNPV bacmids were identified and confirmed by PCR (data not shown) and used to transfect HzAM1 cells. At 96 h.p.t., green fluorescence was observed in transfected cells indicating successful transfection (Fig. 2, upper panel). Progeny virus was harvested from transfected HzAM1 cells and used to infect new batches of cells. Green fluorescence was observed in most infected cells indicating production of infectious progeny viruses from all recombinant HearNPVs (Fig. 2, lower panel).
Figure 2. Transfection and infection assay of recombinant viruses. Images with black background are green fluorescent micrographs of infected HzAM1 cells, all at ×10 magnification. Fluorescence detection of virus infected cells was enabled by expression of EGFP from the pif-replaced recombinant HearNPV bacmids. Supernatants with progeny viruses produced from transfected cells (upper panel) were used to infect a fresh batch of HzAM1 cells (lower panel).
To further determine if the substitution of MabrNPV pifs has any impact on BV production, single-step growth curves of the recombinant viruses were conducted. The results showed that all recombinant viruses replicated with similar kinetics to that of the control virus HaBac-egfp-ph (Fig. 3). Statistical analyses showed that the virus titres of HaBacD pif1-Mbpif1, HaBacΔpif2-Mbpif2 and HaBacΔpif3-Mbpif3 were not significantly different from that of HaBac-egfp-ph at most time points. These results indicate that the substitution of MabrNPV PIFs do not affect BV production in vitro.
Figure 3. Single-step growth curves of recombinant HearNPVs in HzAM1 cells. HzAM1 cells were infected with recombinant HearNPV BVs at an MOI of 5 TCID50/cell. The supernatants were harvested at different times post infection and the titers (TCID50) were determined by end-point dilution assay. Each data point represents the average from three independent infections, and error bars represent the standard deviations. Statistical analyses were carried out using SPSS 20 statistical software.
-
Cells infected with pseudotyped viruses, HaBacΔpif1-Mbpif1, HaBacΔpif2-Mbpif2andHaBacΔpif3-Mbpif3, were confirmed not to synthesize the replaced HaPIFs (Fig. 4A) by Western blot analyses using antibodies against HaPIFs (Song et al. 2008). Anti-FLAG antiserum was used to detect MbPIFs in OBs from cells infected with the pseudotyped viruses. Bands with sizes corresponding to the respective MabrNPV PIFs were detected: MbPIF1 (~ 61 kDa), MbPIF2(~ 48 kDa) andMbPIF3(~ 23 kDa)(Fig. 4B).In the sample of HaBacΔpif1-Mbpif1, bands of ~ 100, ~ 55 and ~ 50 kDa were also detected, which may due to the cross reaction of the antibody, or the degradation and aggregation of PIF1. The Western blot results confirmed successful construction of the pseudotyped HearNPVs.
Figure 4. Expression of HaPIFs and MbPIFs in infected cells. Recombinant viruses; vHaBac-WT-egfp-ph, vHaBacΔpif1-Mbpif1, vHaBacΔpif2-Mbpif2 and vHaBacΔpif3-Mbpif3 were used to infect HzAM1 cells, and the cells were collected at 72 h.p.i. for Western blots analysis. A Primary antibodies, anti-HaPIF1, anti-HaPIF2, antiHaPIF3 and anti-HaVP39 polyclonal antibodies were used to verify HearNPV PIFs knock-outs. B Anti-FLAG monoclonal antibody was used to identify the expression of MbPIFs. Black arrow heads indicate bands of MbPIFs at expected sizes.
-
To determine systemic infectivity by pseudotyped viruses, aliquot of 10 μL of 5 × 106 TCID50 units/mL of each pseudotyped viruses was injected into the hemolymph of late third instar H. armigera larvae. At 96 h post infection, green fluorescence was observed in the hemocytes, trachea, fatbody, midgut lumen and malphigian tubular tissues of all the recombinant viruses infected larvae indicating successful systemic infection (Fig. 5). Of all the cells and organs tested, the haemocytes showed the least amount of infection. All test larvae died within 10 days post infection (data not shown).
Figure 5. Systemic infection of H. armigera larvae with recombinant HearNPVs. Green fluorescent micrographs of infected larval tissues of 4th instar larvae at 96 h.p.i., were produced under ×200 magnification. The infected larval tissues were dissected out and EGFP from the pif-replaced recombinant HearNPV bacmids was observed by fluorescent microscopy.
-
OBs from dead larvae were extracted, purified, quantified and examined by electron microscopy. SEM showed that the OBs of the pseudotyped viruses were with smooth surface and similar size to those of the control virus (Fig. 6, upper panel). TEM further showed that all the OBs contained an electron dense polyhedron envelope, and contain singly enveloped virions (Fig. 6, lower panel). Therefore, all pseudotyped viruses showed normal OB and ODV morphologies.
Figure 6. EM analyses of OBs from wild-type and recombinant HearNPVs. OBs from larvae infected with HearNPV-G4 and PIF-replaced recombinant HearNPVs were extracted and purified. SEM was conducted with a Tecnai electron microscope operated at 200 kV and bars stand for 1 μm (upper panel). TEM was conducted with a 200 kV FEI Tecnai G220 TWIN microscope and the bars represent 200 nm (lower panel).
Feeding assays were performed with a very high dose (3 × 108 OBs/mL) of pseudotyped viruses. The results showed that HaBacΔpif1-Mbpif1 and HaBacΔpif2-Mbpif2 completely lost their oral infectivity and the test larvae were not affected by the high viral dose (Table 1). Only HaBacΔpif3-Mbpif3 was partially infective causing mortality in about 50% of the infected larvae. The control virus, HaBac-egfp-ph, caused 100% mortality with the same dose (Table 1).
Table 1. Results of feeding assays with pseudotyped viruses in the 3rd instar H. armigera.
To determine the mean lethal concentration (LC50) of HaBacΔpif3-Mbpif3, bioassay was conducted with concentrations of 1 × 108, 3 × 107, 1 × 107, 3 × 106 and 1 × 106 OBs/mL for HaBacΔpif3-Mbpif3, which were 1000 times higher than those of the control virus (Table 2). HaBacΔpif3-Mbpif3 caused some mortality at the higher doses of 3 × 107 and 1 × 108 OB/mL but the rates were too low to determine an LC50 (Table 2). In contrast, the control virus, HaBac-egfp-ph caused mortality (Table 2) with an LC50 of 5.7 × 103 OB/mL.
Table 2. Bioassay results of HaBac-egfp-ph and HaBacΔpif3-Mbpif3 in 3rd instar H. armigera.
-
To determine if PIF complex exists in the pseudotyped viruses, ODVs from all three viruses were suspended in Laemmli buffer and heated at either 50 or 95 ℃ and analyzed by PAGE. Western blots with anti-HaPIF1 or antiHaVP91 antibodies showed the control virus, HaBac-egfp-ph had a PIF complex at ~ 170 kDa when heated to 50 ℃ (Fig. 7, red arrow heads). It is interesting that VP91, which is the most recently described member (PIF8, Javed et al. 2017) of the PIF family, appears to be a member of the complex. The band (Fig. 7, white arrow heads), detected with anti-HaPIF1, demonstrates that HaBacΔpif3-Mbpif3 can form a complex, but HaBacΔpif2-Mbpif2 does not (Fig. 7, left panel). Since HaBacΔpif1-Mbpif1 does not contain HaPIF1, anti-HaPIF2 and anti-VP91were used to detect PIF complex. The data showed that HaBacΔpif1-Mbpif1 also did not form a PIF complex (Fig. 7, right panel). ODV tegument protein GP41 was used as a loading control. The results indicated that substitution of MabrNPV PIF1 or PIF2 impaired the assembly of PIF complex, while MbPIF3 interacted with other PIFs of HearNPV to form the complex. These data further corroborate the bioassay results that only HaBacΔpif3-Mbpif3 retained oral infectivity.
Figure 7. Detection of PIF complex in recombinant HearNPVs. OBs were extracted from infected cells at 7 d.p.i. and ODVs were liberated from the OBs by DAS treatment, concentrated and resuspended in Laemmli buffer. The ODV samples were heat treated at 50 ℃ (50) or 95 ℃ (95) for 5 min prior to SDS-PAGE analysis. ODVs extracted from 1 × 107 OBs were loaded into each well of the PAGE gel. Further protein detection was done using primary polyclonal antibodies anti-HaPIF1, anti-HaPIF2 and anti-HaVP91 for detecting PIF complex, and anti-HaGP41 for detecting ODV tegument protein GP41.