Citation: Fu-ying ZHENG, Guo-zhen LIN, Chang-qing QIU, Kui-zhang YUAN, Jun-ying SONG. Expression and Antigenic Characterization of the Epitope-G1 of the Bovine Ephemeral Fever Virus Glycoprotein in Pichia pastoris* .VIROLOGICA SINICA, 2007, 22(5) : 347-352.

Expression and Antigenic Characterization of the Epitope-G1 of the Bovine Ephemeral Fever Virus Glycoprotein in Pichia pastoris*

  • Corresponding author: Chang-qing QIU, cqqiu@126.com
  • Received Date: 29 November 2006
    Accepted Date: 19 July 2007
    Available online: 01 October 2007

    Fund Project: National Dairy Foundation of China 2002BA518A04

  • The epitope-G1 gene of Bovine ephemeral fever virus (BEFV) glycoprotein was synthesised by PCR and cloned into expression vector pPIC9K to construct recombinant plasmid pPIC9K-G1. Then the pPIC9K-G1 was linearized and transformed into Pichia pastoris GS115. The recombinant P. pastoris strains were selected by a G418 transformation screen and confirmed by PCR. After being induced with methanol, an expressed protein with 26 kDa molecular weight was obtained, which was much bigger than the predicted size (15.54 kDa). Deglycosylation analysis indicated the recombinant G1 was glycosylated. Western blot and ELISA tests, as well as rabbit immunization and specificity experiments indicated that the target protein had both higher reaction activity and higher immunocompetence and specificity. The recombinant G1 protein could be used as a coating antigen to develop an ELISA kit for bovine ephemeral fever diagnosis.

  • 加载中
    1. 1. Hsieh Y C, Chen S H, Chou C C, et al.2005.Bovine ephemeral fever in Taiwan (2001-2002).J Vete Med Sci, 67:411-416.
        doi: 10.1292/jvms.67.411

    2. 2. Hsieh Y C, Chen S H, Chou C S, et al.2005. Development of a reliable assay protocol for identification of diseases(RAPID)-bioactive amplification with probing (BAP) for detection of bovine ephemeral fever virus.J Virol Methods, 129:75-82.
        doi: 10.1016/j.jviromet.2005.05.009

    3. 3. Hsieh Y C, Wang S Y, Lee Y F, et al.2006.DNA sequence analysis of glycoptotein G gene of bovine ephemeral fever virus and development of a double oil emulsion vaccine against bovine ephemeral fever.J Vete Med Sci, 68:543-548.
        doi: 10.1292/jvms.68.543

    4. 4. Kongsuwan K, Cybinski D H, Cooper J, et al.1998. Location of neutralizing epitopes on the G protein of bovine ephemeral fever rhabdovirus.J Gen Virol, 79:2573-2581.
        doi: 10.1099/0022-1317-79-11-2573

    5. 5. Stram Y, Kuznetzova L, Levin A, et al.2005.A real-time RT-quantative(q)PCR for the detection of bovine ephemeral fever virus.J Virol Methods, 130:1-6.
        doi: 10.1016/j.jviromet.2005.05.024

    6. 6. Walker P J.2005.Bovine ephemeral fever in Australia and the world.Current Topics in Microbiol Immunol, 292:57-80.

    7. 7. Yeruham I, Sharir B, Yadin H, et al.2003.Bovine ephemeral fever in beef cattle herds in the Jordan Valley, Israel.Veter Rec, 152:86-88.
        doi: 10.1136/vr.152.3.86

    8. 8. Yin Z, Liu J H. 1997. Animal Virology. Second edition. Beijing: Science Press, 795-799. (in chinese)

    9. 9. Zakrzewski H, Cybinski D H, Walker P J.1992.A blocking ELISA for the detection of specific antibodies to bovine ephemeral fever virus.J Immunol Methods, 151:287-289.

  • 加载中

Figures(5)

Article Metrics

Article views(5654) PDF downloads(0) Cited by()

Related
Proportional views

    Expression and Antigenic Characterization of the Epitope-G1 of the Bovine Ephemeral Fever Virus Glycoprotein in Pichia pastoris*

      Corresponding author: Chang-qing QIU, cqqiu@126.com
    • 1. Key Laboratory of Animal Virology of Ministry of Agriculture, State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou 730046, China
    • 2. Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin 150001, China
    Fund Project:  National Dairy Foundation of China 2002BA518A04

    Abstract: The epitope-G1 gene of Bovine ephemeral fever virus (BEFV) glycoprotein was synthesised by PCR and cloned into expression vector pPIC9K to construct recombinant plasmid pPIC9K-G1. Then the pPIC9K-G1 was linearized and transformed into Pichia pastoris GS115. The recombinant P. pastoris strains were selected by a G418 transformation screen and confirmed by PCR. After being induced with methanol, an expressed protein with 26 kDa molecular weight was obtained, which was much bigger than the predicted size (15.54 kDa). Deglycosylation analysis indicated the recombinant G1 was glycosylated. Western blot and ELISA tests, as well as rabbit immunization and specificity experiments indicated that the target protein had both higher reaction activity and higher immunocompetence and specificity. The recombinant G1 protein could be used as a coating antigen to develop an ELISA kit for bovine ephemeral fever diagnosis.

    • Bovine ephemeral fever (BEF) caused by Bovine ephemeral fever virus (BEFV), is an acute epidemic infection in cattle and water buffalo. The disease was first found in East Africa, and has spread rapidly in many countries of Africa, Asia and Oceania (1, 6, 7). The infection causes considerable economic loss in the cattle industry including the reduced output and quality of the milk, and abortion and lameness or paralysis.

      At present, the virus neutralization (VN) test is the standard method for detecting anti-BEFV antibody, however, asepsis is a strict requirement in this method, and consequently it is difficult to perform under the common conditions. In 1992, a blocking enzyme-linked immunosorbent assay (b-ELISA) was estab-lished which could detect specific antibodies to the antigenic site G1 of the BEFV glycoprotein in cattle serum. Compared with the VN test, the b-ELISA was more sensitive and simpler to perform (9). Also, some diagnostic methods based on PCR have been established in some laboratories (2, 5). However, the PCR detecting method has not been used widely. In this paper, the Epitope G1 of BEFV was successfully expressed in P. pastoris GS115 and characterized successfully. These findings provide the basis for the development of an ELISA kit for BEF diagnosis.

    • The pMD-G1 plasmid was constructed before this research; Pichia pastoris GS115, E.coli BL21(DE3) and pPIC9K vector were purchased from Invitrogen (California, USA); pMD18-T Simple Vector, M-MLV, Premix Taq, EcoR I and NotI were purchased from TaKaRa (Dalian, China); sera to Rabies virus (RV) were kept in the State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute; YNB, D-Sorbitol, G418, BSA, rabbit against dog HRP-IgG (H+L) and rabbit against bovine HRP-IgG (H+L) were purchased from Sangon (Shanghai, China); the positive sera, negative sera and the vaccine to BEFV were kindly provided by Prof Kuizhang Yuan at Harbin Veterinary Research Institute in China; Endo H was purchased from Seikagaku Co.

    • The epitope-G1 gene was amplified from the pMD-G plasmid using primers 420F (5'GAATTCAGAGCT TGG TGT GAA TAC 3', EcoR I site underlined) and 420B (5'GCGGCCGCCCAACCTACAACAGCAGA TA 3', Not I site underlined). After the initial dena-turation at 94℃for 5 min, the amplification proceeded through a total of 35 cycles consisting of denaturation at 94 ℃ (40s), annealing at 46 ℃ (1min), primer extension at 72℃ (40s) and a final extension for 10min at 72℃. The PCR product was cloned into pMD 18-T vector and the positive recombinant plasmid was named pMD-G1. The pMD-G1 was digested with EcoR I and Not I, and the target fragment was inserted into the EcoR I and Not I sites of the expression vector pPIC9K to form the plasmid pPIC9K-G1.

    • pPIC9K-G1 was linearized with the Sac I enzyme and transformed into Pichia pastoris GS115 using the electron transformation method following the manufac-turer's instructions. The transformed cells were selected in medium MD and antibiotic G418, and were confirmed by PCR amplification using the sequencing primers 5'AOX1 (5'GACTGGTTCCAA TTGACAAGC 3') and 3'AOX1 (5'GCAAATGGC ATTCTGACATCC 3'). The expression of the target protein was induced with 0.5% methanol. 1 mL fermentation cultures were removed after induction for 24h, 48h, 72h, respectively, the supernatant liquids were collected by centrifugation and the expressed target proteins were separated by SDS-PAGE, respec-tively. At the same time, methanol was added every 24h to a final concentration of 0.5% in the fermen-tation culture in order to continue induction.

    • For the purpose of confirming the optimal induction time, a single clone of recombinant Pichia pastoris GS115 was induced for 144h with 0.5% methanol, and 1 mL medium was taken out every 24h. In order to analyze the optimal concentration of methanol, the same clone of GS115 was induced for 72h with 0.25%, 0.5%, 1% and 2% methanol, respectively. In addition, the GS115 strain was induced in pH 5.5 and pH 6.5 medium, respectively. Then all the samples obtained above were analyzed by SDS-PAGE.

    • The culture supernatant was harvested by centrifu-gation for 20 min at 5 000g after methanol induction for 72 h and the supernatant was concentrated by freeze drying. The freeze-dried protein was dissolved with distilled water to a concentration of 50mg/mL. 1 mL protein solution was then passed through a Sephadex-200 column equilibrated with PBS buffer (pH 7.4) with a flow velocity 0.5mL/min. The column was washed with washing buffer (PBS, pH 7.4), and the recombinant protein was eluted with PBS buffer (pH 7.4). 20μL purified protein solution was mixed with equal amount (V) of 10×Glycoprotein buffer boiled for 10min and then incubated at 37℃ for 1h after adding 5μL 10×G5 buffer and 5μL Endo H for glycosylation analysis. This final product was served as a test sample. Finally, the sample added with an equal amount (V) of loading buffer and separated using 12% SDS-PAGE gel electrophoresis.

    • The fermentation culture collected by centrifugation was analyzed by Western blot. Additionally, the purified recombinant protein was used as a coating antigen to detect 10 positive sera and 12 negtive sera to BEFV by indirect ELISA, which had been confirmed by a VN test for BEF. The reaction activity of the protein could be determined based on the OD490 value. 5 rabbits were inoculated with the target protein(200μg/rabbit) mixed with equal volume of Freund's adjuvant (complete), and the booster immunizations with equal volume of the expressed protein mixed with Freund's adjuvant (incomplete) were carried out after two weeks. At the same time, another 5 rabbits were inoculated with inactivated vaccine to BEFV (1mL/rabbit), with similar booster immunization two weeks later. The blood specimens were sampled from all the tested rabbits in the first, second and third weeks after the booster vaccination, respectively, and antibody levels against BEF in the sera were detected by indirect ELISA.

    • The purified protein was used as antigen to detect 8 positive sera against the rabies virus (RV) in order to test cross-reaction (Both RV and BEFV belong to Rhabdoviridae).

    • The epitope-G1 gene subcloned into the vector pPIC9K was identified by PCR and enzyme digestion, respectively. The results showed that the epitope-G1 gene was correctly inserted into the expression vector, and the target gene was 420 bp in size (Fig. 1).

      Figure 1.  Identification of pPIC9K-G1 plasmid by PCR and enzyme digestion. 1, DNA Marker; 2, Product of pPIC9K-G1 plasmid by PCR; 3, pPIC9K-G1 plasmid digested with EcoR I and Not I.

    • Chromosomal DNA of transformed Pichia pastoris GS115 was used as template DNA to confirm that the epitope-G1 gene had been integrated in the recombi-nant Pichia pastoris GS115. The PCR product made from pPIC9K by the 5'AOX and 3'AOX primers was 492 bp in size and the epitope-G1 gene was 420 bp in size. The expected size of gene integrated into the chromosomal DNA was approximately 912 bp (Fig. 2).

      Figure 2.  Identification of Pichia pastoris GS115 transformed by PCR. 1, 2 kb DNA Marker; 2-3, The PCR products from transformed chromosomal DNA of P.pastoris GS115.

    • Pichia pastoris GS115 transformed was induced for 72h with 0.5% methanol. No protein was observed when the recombinant strain GS115 was induced for 24h, and an~ 26.0 kDa protein was obtained after induction for 48h (Fig.3).

      Figure 3.  SDS-PAGE analysis of the expression products of GS115/ pPIC9K-G1. 1, Low molecular weight protein Marker; 2-4, Expression product of GS115/pPIC9K-G1 induced for 24h, 48h and 72h.

    • By analysis of the target protein obtained under different induction conditions, the optimal expression conditions were found to be when the recombinant strain GS115 was induced for 72h in pH 5.5 medium with 1% methanol.

    • The target protein and coloring matter in the fer-mentation broth were separated by Sephadex-200 filtration chromatography. The target protein was 26.0 kDa in size before deglycosylation and became 15.54 kDa in size after deglycosylation, which was con-sistent with the theoretic value, which proved that the target protein was surely glycosylated in the recom-binant Pichia pastoris GS115 (Fig.4).

      Figure 4.  SDS-PAGE analysis of the target protein purified and deglycosylated. 1, Low molecular weight protein Marker; 2-3, Protein purif the target ied; 4-5, The protein deglycosylated

    • In a Western blot analysis, the band of the target protein expressed in Pichia pastoris GS115 was appeared at 26.0 kDa (Fig.5). The target protein (5μg/well) was used as coating antigen and the dilutions of the sera and HRP-IgG were 1:80 and 1:800 ratio, respectively. The 10 sera positive for BEF were detected by indirect ELISA and the average of OD490 reading was 1.113±0.265, while the average of OD490 reading from the 12 negative sera was 0.237±0.027. On the other hand, when the deglycosy-lated protein was used as antigen to detect the positive sera and negative sera above, the averages of OD490 were 1.077±0.254 and 0.224±0.030, respectively.

      Figure 5.  Western blot analysis of expression protein of GS115/ pPIC9K-G1. 1, Low molecular weight protein Marker; 2-3, The target protein expressed in GS115/pPIC9K-G1

      The sera of rabbits were collected three times after inoculation. The sera from rabbits inoculated with the vaccine to BEFV were detected by indirect ELISA, and the averages of OD490 were 0.601±0.094, 0.998± 0.132 and 1.225±0.252 respectively. The averages of OD490 of the sera inoculated with the target protein were 0.576±0.079, 0.823±0.141 and 1.012±0.185 respectively. All the rabbits produced antibodies.

    • The average of OD490 detecting the 8 positive sera to RV with the target protein purified was 0.256±0.020 which was close to the datum obtained from the negative sera to BEFV. It showed no cross-reaction between the sera to RV and BEFV.

    • Our aim was to express a protein which specifically combined with anti-BEFV antibody but not with other related antibody, so that the protein could be used as a coating antigen for ELISA with a view to clinically monitoring BEF. The G1 epitope is specific to BEFV and only reacts with the anti-BEFV neutralizing antibody (3, 4, 8). We cloned the gene including the G1 site and expressed it in Pichia pastoris GS115. The cloned epitope-G1 gene was 420bp and the recombi-nant protein 140 aa, mapped to aa 390-529 of the G protein. The gene sequence includes three potential glycosylated sites, so the target protein can be moderately glycosylated to ensure the configuration is predominantly innate.

      The protein (approximately 26.0 kDa) expressed from Pichia pastoris GS115 is larger than expected (15.54 kDa). However the target protein reduces to 15.54 kDa after deglycosylation by Endo H, which indicates that the proein is surely glycosylated and it is a glycoprotein. The glycosylated and deglycosylated protein were used in turn as an antigen to detect the same sera, and our results show that their activity has no obvious difference in an ELISA test.

      We also confirmed that the expressed protein has significant biological activity by Western blot analysis, ELISA and immunizion of rabbits. However, it is also very important to ensure the protein has high specificity functioning as an antigen. In China, it is reported that only RV and BEFV belonging to Rhabdoviridae, can infect cattle, so the sera to RV were detected with the expressed protein to test for cross-reaction. Our results showed that the purified recombinant protein has high specificity with no evidence of cross reaction with anti-RV antibody. Thus, the protein has potential for us as a coating antigen in the development of an ELISA Kit for diagnosing bovine ephemeral fever.

    Figure (5)  Reference (9) Relative (20)

    目录

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return