Zheng Hou and Gengfu Xiao. Total Chemical Synthesis, Assembly of Human Torque Teno Virus Genome[J]. Virologica Sinica, 2011, 26(3): 181-189. doi: 10.1007/s12250-011-3187-8
Citation: Zheng Hou, Gengfu Xiao. Total Chemical Synthesis, Assembly of Human Torque Teno Virus Genome .VIROLOGICA SINICA, 2011, 26(3) : 181-189.  http://dx.doi.org/10.1007/s12250-011-3187-8

Total Chemical Synthesis, Assembly of Human Torque Teno Virus Genome

cstr: 32224.14.s12250-011-3187-8
  • 通讯作者: Gengfu Xiao, xiaogf@wh.iov.cn
  • 收稿日期: 2011-01-29
    录用日期: 2011-03-02
  • Torque teno virus (TTV) is a nonenveloped virus containing a single-stranded, circular DNA genome of approximately 3.8kb. We completely synthesized the 3 808 nucleotides of the TTV (SANBAN isolate) genome, which contains a hairpin structure and a GC-rich region. More than 100 overlapping oligonucleotides were chemically synthesized and assembled by polymerase chain assembly reaction (PCA), and the synthesis was completed with splicing by overlap extension (SOEing). This study establishes the methodological basis of the chemical synthesis of a viral genome for use as a live attenuated vaccine or gene therapy vector.

Total Chemical Synthesis, Assembly of Human Torque Teno Virus Genome

  • Corresponding author: Gengfu Xiao, xiaogf@wh.iov.cn
  • Received Date: 29 January 2011
    Accepted Date: 02 March 2011

    Fund Project: The Knowledge Innovation Program of the Chinese Academy of Sciences KSCX2-EW-Z-3

  • Torque teno virus (TTV) is a nonenveloped virus containing a single-stranded, circular DNA genome of approximately 3.8kb. We completely synthesized the 3 808 nucleotides of the TTV (SANBAN isolate) genome, which contains a hairpin structure and a GC-rich region. More than 100 overlapping oligonucleotides were chemically synthesized and assembled by polymerase chain assembly reaction (PCA), and the synthesis was completed with splicing by overlap extension (SOEing). This study establishes the methodological basis of the chemical synthesis of a viral genome for use as a live attenuated vaccine or gene therapy vector.

  • 加载中
    1. Agarwal K L, Büchi H, Caruthers M H, et al. 1970. Total synthesis of the gene for an alanine transfer ribonucleic acid from yeast. Nature, 227 (5253): 27-34.
        doi: 10.1038/227027a0

    2. Bendinelli M, Pistello M, Maggi F, et al. 2001. Molecular properties, biology, and clinical implications of TT virus, a recently identified widespread infectious agent of humans. Clin Microbiol Rev, 14 (1): 98-113.
        doi: 10.1128/CMR.14.1.98-113.2001

    3. Camci C, Guney C, Balkan A, et al. 2002. The prevalence of TT virus in cancer patients. New Microbiol, 25 (4): 463-468.

    4. Cello J, Paul A V, Wimmer E. 2002. Chemical synthesis of poliovirus cDNA: generation of infectious virus in the absence of natural template. Science, 297 (5583): 1016-1018.
        doi: 10.1126/science.1072266

    5. Dillon P J, Rosen C A. 1990. A rapid method for the construction of synthetic genes using the polymerase chain reaction. Biotechniques, 9 (3): 298-300.

    6. Gibson D G, Glass J I, Lartigue C, et al. 2010. Creation of a bacterial cell controlled by a chemically synthesized genome. Science, 329 (5987): 52-56.
        doi: 10.1126/science.1190719

    7. Hapgood J P, Riedemann J, Scherer S D. 2001. Regulation of gene expression by GC-rich DNA cis-elements. Cell Biol Int, 25 (1): 17-31.
        doi: 10.1006/cbir.2000.0674

    8. Hijikata M, Takahashi K, Mishiro S. 1999. Complete circular DNA genome of a TT virus variant (isolate name SANBAN) and 44 partial ORF2 sequences implicating a great degree of diversity beyond genotypes. Virology, 260 (1): 17-22.
        doi: 10.1006/viro.1999.9797

    9. Horton R M. 1995. PCR-mediated recombination and mutagenesis. SOEing together tailor-made genes. Mol Biotechnol, 3 (2): 93-99.
        doi: 10.1007/BF02789105

    10. Hu Z J, Lang Z W, Zhou Y S, et al. 2002. Clinic pathological study on TTV infection in hepatitis of unknown etiology. World J Gastroenterol, 8 (2): 288-293.

    11. Jelcic I, Hotz-Wagenblatt A, Hunziker A, et al. 2004. Isolation of multiple TT virus genotypes from spleen biopsy tissue from a Hodgkin's disease patient: genome reorganization and diversity in the hypervariable region. J Virol, 78 (14): 7498-7507.
        doi: 10.1128/JVI.78.14.7498-7507.2004

    12. Liu X, Kong S, Shi M, et al. 2008. Genomic analysis of freshwater cyanophage Pf-WMP3 infecting cyanobacterium Phormidium foveolarum: the conserved elements for a phage. Microb Ecol, 56 (4): 671-680.
        doi: 10.1007/s00248-008-9386-7

    13. Miyata H, Tsunoda H, Kazi A, et al. 1999. Identification of a novel GC-rich 113-nucleotide region to complete the circular, single-stranded DNA genome of TT virus, the first human circovirus. J Virol, 73 (5): 3582-3586.

    14. Mushahwar I K, Erker J C, Muerhoff A S, et al. 1999. Molecular and biophysical characterization of TT virus: evidence for a new virus family infecting humans. Proc Natl Acad Sci USA, 96 (6): 3177-3182.
        doi: 10.1073/pnas.96.6.3177

    15. Nishizawa T, Okamoto H, Konishi K, et al. 1997. A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology. Biochem Biophys Res Commun, 241 (1): 92-97.
        doi: 10.1006/bbrc.1997.7765

    16. Okamoto H, Nishizawa T, Ukita M. 1999. A novel unenveloped DNA virus (TT virus) associated with acute and chronic non-A to G hepatitis. Intervirology, 42 (2-3): 196-204.
        doi: 10.1159/000024961

    17. Okamoto H, Ukita M, Nishizawa T, et al. 2000. Circular double-stranded forms of TT virus DNA in the liver. J Virol, 74 (11): 5161-5167.
        doi: 10.1128/JVI.74.11.5161-5167.2000

    18. Peng Y H, Nishizawa T, Takahashi M, et al. 2002. Analysis of the entire genomes of thirteen TT virus variants classifiable into the fourth and fifth genetic groups, isolated from viremic infants. Arch Virol, 147 (1): 21-41.
        doi: 10.1007/s705-002-8301-7

    19. Sekiya T, Takeya T, Brown E L, et al. 1979. Total synthesis of a tyrosine suppressor transfer RNA gene. XVI. Enzymatic joining to form the total 207-base pair-long DNA. J Biol Chem, 254 (13): 5787-5801.

    20. Smith H O, Hutchison C A 3rd, Pfannkoch C, et al. 2003. Generating a synthetic genome by whole genome assembly: phiX174 bacteriophage from synthetic oligonucleotides. Proc Natl Acad Sci USA, 100 (26): 15440-15445.
        doi: 10.1073/pnas.2237126100

    21. Stemmer W P, Crameri A, Ha KD, et al. 1995. Single-step assembly of a gene and entire plasmid from large numbers of oligodeoxyribonucleotides. Gene, 164 (1): 49-53.
        doi: 10.1016/0378-1119(95)00511-4

    22. Takahashi K, Iwasa Y, Hijikata M, et al. 2000. Identification of a new human DNA virus (TTV-like mini virus, TLMV) intermediately related to TT virus and chicken anemia virus. Arch Virol, 145 (5): 979-993.
        doi: 10.1007/s007050050689

    23. Takahashi K, Hijikata M, Samokhvalov E I, et al. 2000. Full or near full length nucleotide sequences of TT virus variants (Types SANBAN and YONBAN) and the TT virus-like mini virus. Intervirology, 43 (2): 119-123.
        doi: 10.1159/000025034

    24. Xiong A S, Yao Q H, Peng R H, et al. 2004. A simple, rapid, high-fidelity and cost-effective PCR-based two-step DNA synthesis method for long gene sequences. Nucl Acids Res, 32 (12): e98.
        doi: 10.1093/nar/gnh094

    25. Yoshida T, Nagasaki K, Takashima Y, et al. 2008. Ma-LMM01 infecting toxic Microcystis aeruginosa illuminates diverse cyanophage genome strategies. J Bacteriol, 190 (5): 1762-1772.
        doi: 10.1128/JB.01534-07

  • 加载中

Figures(5)

Article Metrics

Article views(6402) PDF downloads(18) Cited by(0)

Related
Proportional views
    通讯作者: 陈斌, bchen63@163.com
    • 1. 

      沈阳化工大学材料科学与工程学院 沈阳 110142

    1. 本站搜索
    2. 百度学术搜索
    3. 万方数据库搜索
    4. CNKI搜索

    Total Chemical Synthesis, Assembly of Human Torque Teno Virus Genome

      Corresponding author: Gengfu Xiao, xiaogf@wh.iov.cn
    • State Key Laboratory of Virology, Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China
    Fund Project:  The Knowledge Innovation Program of the Chinese Academy of Sciences KSCX2-EW-Z-3

    Abstract: Torque teno virus (TTV) is a nonenveloped virus containing a single-stranded, circular DNA genome of approximately 3.8kb. We completely synthesized the 3 808 nucleotides of the TTV (SANBAN isolate) genome, which contains a hairpin structure and a GC-rich region. More than 100 overlapping oligonucleotides were chemically synthesized and assembled by polymerase chain assembly reaction (PCA), and the synthesis was completed with splicing by overlap extension (SOEing). This study establishes the methodological basis of the chemical synthesis of a viral genome for use as a live attenuated vaccine or gene therapy vector.

    • Ever since the pioneering work of the Khorana' group that synthesized the 77-bp nucleotide gene encoding a yeast alanine transfer RNA and the 207-bp gene for the tyrosine suppressor tRNA[1, 19] 40 years ago, scientists have had the ability to join DNA sequences and produce combinations that are not present in nature. Recently, chemical synthesis of genes has become routine, and the chemical synthesis of genomes has now become a reality and several viral genomes generated by the chemical synthesis have been reported[4, 20]. Gibson et al. developed a method for assembling the 1.08-mega-base Mycoplasma mycoides genome staring from digitized genome sequence information, and successfully transplanted it into a Mycoplasma capricolum recipient cell to create a modified Mycoplasma mycoides cell controlled by a synthetic genome [6].

      Transfusion Transmitted Virus was first reported as a post-transfusion hepatitis virus of unexplained etiology in Japanese patients in 1997[14, 15] and was recently named as Torque teno virus (TTV) as the first member of the new family Anelloviridae. The virus is a nonenveloped virus containing a single-stranded, circular DNA genome of approximately 3.8 kb [13, 22]. Until now, at least 39 genotypes of TTV have been identified, and they can be classified into five distantly related groups [18]. The TTV genome includes an untranslated region (UTR) of approximately 1.2kb and a coding region of approximately 2.6kb, including two main open reading frames (ORFs) which are sandwiched by the TATA box and polyadenylation signal motifs[13, 14, 16]. Epidemiological studies have shown that TTV is genetically variable and widespread in the general human population[2]. Although replication of TTV indicates that it occurs in the liver [17], and most researchers have considered that it might have a possible association with non-A-G hepatitis, post-transfusion hepatitis which may induce liver disease [3, 10, 15, 16], to date there is no consistent evidence of a link between TTV infection of humans and specific disease [11]. The virus is extremely common, even in healthy individuals-as much as 100% prevalent in some countries, and in approximately 10% of blood donors in the UK and the US. The exact role of this virus in the pathogenesis of chronic liver diseases remains controversial.

      In this study, we obtained the entire 3.8 kb synthetic TTV genome using a purely in vitro process. Through this work, some experience in assembling the genomes containing complex structures from oligonucleotides has been gained, thereby we can reconstruct viral genomes less than 10 kb and accelerate the preparation of live attenuated vaccines. Viruses also represent natural systems which can deliver foreign genes into target cells; therefore, the artificial TTV genome could be developed as a hepatic disease gene therapy vector in the future.

    • PCA and SOEing methods

      PCA (polymerase chain assembly reaction) is a method of assembling many oligonucleotides into a longer double-strand DNA employing thermostable polymerase [5]. We used PCA to obtain assembled cassettes from chemically synthetic oligonucleotides and then added a subsequent PCR step based on the two terminal oligos to amplify the assembled product (Fig. 1). SOEing (splicing by overlap extension) is a method for joining two PCR products into one with short homologous sequence [9]. We used SOEing to obtain assembled earlier intermediates and the full length viral genome from cassettes and latter intermediates. In our experiment, we used more than two PCR products as the templates, let them extend with partial overlaps anneal at the first reaction and then added a subsequent PCR based on the two terminal oligos to amplify the full length product (Fig. 1).

      Figure 1.  Two methods for assembly of oligos or cassettes. Synthetic oligonucletides are mainly assembled by PCA, cassettes and intermediates are mainly assembled by SOEing

      Synthetic oligonucleotides design

      TTV (SANBAN isolate) genome (GenBank accession number AB025946) [23] was divided into 102 overlapping oligos. These coupled primers were named F1/R1, F2/R2, …, F51/R51. The chemical synthesis oligonucleotides were generally 55-60 base oligos with 15-20 bases overlaps to adjacent oligos and purchased from Sangon Biotech (Shanghai) with ULTRAPAGE purification. The stock solutions were prepared at a concentration of 100 μmol/L in Tris/EDTA (TE) buffer, pH 8.0.

      Preparation and assembly of ~400 bp cassettes

      Oligonucleotides were assembled by PCA method. PCA was carried out in 25 μL reaction mixtures containing 400 nmol/L each of the 8 or 10 oligos (4 or 5 coupled primers), 200 μmol/L each dNTP, 1.2 mmol/L MgSO4, 0.5 μL KOD-PLUS DNA polymerase (TOYOBO) and 2.5 μL 10×PCR buffer for KOD-PLUS. The assembled program consisted of 35 cycles of 94℃ for 30 s, 45℃ for 30 s, and 68℃ for 30 s.

      The assembled cassettes produced by PCA were amplified. The 25 μL PCR mixtures contained 1 μL PCA product (unpurified), and 1.5 μL each 10 μmol/L two terminal oligos, 200 μmol/L each dNTP, 1.2 mmol/L MgSO4, 0.5 μL KOD-PLUS DNA poly-merase (TOYOBO) and 2.5 μL 10×PCR buffer for KOD-PLUS. PCR parameters were 94℃ for 2 min, then 32 cycles of 94℃ for 30s, 50℃ for 30 s, and 68℃ for 30s, followed by 68℃ incubation for 5 min. The 75 μL(25 μL×3) PCR amplification products were purified using the Gel Extraction Kit (OMEGA) according to the provided manual, and re-dissolved in 25 μL of steriled ddH2O.

      Preparation and assembly of GC-rich and hairpin structure cassettes

      The TTV (SANBAN isolate) genome has a GC-rich region located at nucleotides 3697-3808 and a stable hairpin structure at nucleotides 3153-3251[8], thus we couldn't assemble the short original oligonucleotides that contained these secondary sequences by PCA. Therefore, we designed a 150 base (R53) and a 128 base (R42-43) single-stranded DNA oligos with 15-20 bases overlaps to adjacent oligos that contained the full-length GC-rich sequence and the hairpin structure sequence respectively, (purchased from Integrated DNA Technologies, Inc (Coralville, Iowa, USA) with standard desalting purification) and dissolved them in 100 μmol/L Tris/EDTA (TE) buffer, pH 8.0.

      The 150 base oligos (R53) and a 128 base oligos (R42-43) had the following sequences: 5'-GTCACG TGGTTAGTGACGGACTTCGGGGGGGGGGCCGGGGGGCAAACCCCCCCCCGGGGGGGGCCCCCCCCTTTCCCCGGGGGGGGCGGCAGCCCCCCGGCGCGCGCGCGCAGCGCGCGCGCCGCCGCCGAGCCGTTATTTTTAAAAAAG-3' and 5'-TCGGA GTCTGTTTAGCAAAATTCCCGACCCCCGCGAGCCCGAAGTGGTCTGACACGCGCGAGCGTGTC AGCACGAGCGGGGGTCTGAGGTGCCGCGCGCAGCCGAAGGCGTAGCGCGCGGCTCCGAAG-3'.

      We set up 25 μL PCA reactions using 400 nmol/L each of the 4 or 6 oligos, 400 μmol/L each dNTP, 0.5 μL KOD-FX DNA polymerase (TOYOBO) and 12.5 μL 2×PCR buffer for KOD-FX. PCR parameters were 94℃ for 2 min, then 32 cycles of 98℃ for 15 s, 58℃ for 30 s, and 68℃ for 1 min, followed by 68℃ incubation for 5 min.

      We amplified the PCA products with two terminal oligos as primers. The 25 μL PCR mixtures contained 1 μL PCA product (unpurified), and 1.5 μL each 10μmol/L forward and reverse oligos, 400 μmol/L each dNTP, 0.5 μL KOD-FX DNA polymerase (TOYOBO) and 12.5 μL 2×PCR buffer for KOD-FX. PCR parameters were 94℃ for 2 min, then 28 cycles of 98℃ for 15 s, 60℃ for 30 s, and 68℃ for 1 min, followed by 68℃ incubation for 5 min. The PCR products were purified and re-dissolved as above.

      DNA cloning and sequencing

      The synthetic DNA fragments were purified by gel extraction and integrated into the vector pTA2 (TOYOBO) using the TA cloning System. The ligation products were transformed into DH5 E. coli cells and selected on LB plates with 50 μg/mL ampicillin, 20 μL 100 mmol/L IPTG and 4% X-gal. Individual E. coli colonies were picked and incubated overnight in 1.0 mL LB liquid medium with 50 μg/mL ampicillin at 37℃.

      To screen for full-length first-stage intermediates, we performed PCR of cultured bacteria. The bacteria were used as templates in a PCR reaction with the primers complementary to the terminal sequences of synthetic DNA fragments. We set up 10 μL reactions using 0.4 μL template, 400 nmol/L each primer, 400 μmol/L each dNTP, 0.2 μL KOD-FX DNA polymerase (TOYOBO) and 5 μL 2×PCR buffer for KOD-FX. Cycling parameters were 94℃ for 2 min, then 32 cycles of 98℃ for 15s, 55℃ for 30 s, and 68℃ 1 kb per 1 min of amplicon, followed by 68℃ incubation for 5 min. We analyzed products on 1% agarose gel alongside the DNA ladder. Plasmids containing the fragments of interest were extracted from these cells using the E.Z.N.A.TM Plasmid Mini Kit (OMEGA) and sequenced.

      Preparation and assembly of ~800 bp intermediates

      We used SOEing to assemble synthetic cassettes produced by PCA.The PCR reaction mixtures (25 μL) contained 1μL each of 2-3 purified 400 bp cassettes, 400 μmol/L each dNTP, 0.5 μL KOD-FX DNA polymerase (TOYOBO) and 12.5 μL 2×PCR buffer for KOD-FX. Cycling parameters were 94℃ for 2 min, then 30 cycles of 98℃ for 15 s, 58℃ for 30 s, and 68℃ 1 kb per 1 min, followed by single 68℃ incubation for 5 min.

      The synthetic intermediates produced by SOEing were amplified. The 25 μL PCR mixtures contained 1 μL unpurified SOEing product, and 1.5 μL each 10 μmol/L forward and reverse primers, 400 μmol/L each dNTP, 0.5 μL KOD-FX DNA polymerase (TOYOBO) and 12.5 μL 2×PCR buffer for KOD-FX. PCR parameters were 94℃ for 2 min, then 28 cycles of 98℃ for 15s, 60℃ for 30 s, and 68℃ 1kb per 1min, followed by single 68℃ incubation for 5 min. The PCR products were purified, cloned and sequenced as above.

      Genome assembly and amplification

      After sequencing, the 2 849 bp, 368 bp and 805 bp verified synthetic intermediates produced by SOEing were amplified and purified as above. We also used SOEing to assembly the synthetic intermediates into the entire TTV genome. The reaction condition was similar to 800 bp intermediates assembly, while the annealing temperature (Ta) was raised by 2℃ in each reaction. The PCR amplification products were purified, cloned and sequenced as above.

    • As many as 5 overlapping oligo pairs are easily assembled into 400 bp cassette at once

      The native 3 808-bp TTV (SANBAN isolate) genome (GenBank accession number AB025946)[23] was divided into 102 overlapping 55-60 base oligos (coupled primers F1/R1, F2/R2, …, F51/R51). Two single-stranded DNA oligos with 15-20 base overlapping could be assembled to 90-100 bp ds-DNA.

      To determine the capacity for oligo assembly in one PCA reaction, we took eight, five, three, two and two oligo pairs as templates in each of five individual PCA reactions. The gel electrophoresis' results showed that, in the first stage of PCA assembly, only a small fraction of full-length assembly product was visible when mixing two or three oligo pairs in reaction mixtures. After second-stage amplification, there were specific assembly bands observed when the oligo pairs were not more than five (Fig. 2). This provided evidence that as many as 5 overlapping oligo pairs are easily assembled into 400 bp cassette at once under our reaction conditions.

      Figure 2.  Gel electrophoresis' analyses of assembly of oligonu-cleotides by two-steps PCA at once. 1-5: Oligonucletides are assembled by PCA assembly reactions; 6-10: PCA assembled products are amplified by PCR. Lane 1, Eight oligo pairs; 2, Five oligo pairs; 3, Three oligo pairs; 4, Two oligo pairs; 5, Two oligo pairs; 6, Eight oligo pairs; 7, Five oligo pairs; 8, Three oligo pairs; 9, Two oligo pairs; 10, Two oligo pairs; 11, DNA Marker I from TransGen Biotech(Beijing)

      Assembly of the TTV genome nucleotides 78-2926 sequence

      To assemble the TTV genome 78-2 926 sequence with oligonucleotides, the 55-60 base oligos were assembled in groups of four or five pairs into eleven 350-400 bp cassettes. These were joined in sets of two or three to produce four assemblies of approximately 800 bp and then again in sets of two to produce two 1.5 kb assemblies. These two fragments were recombined into approximately 3.0 kb (2 849 bp) synthetic intermediates (Fig. 3A). The assembled intermediate 02-38 (the 78-2926 sequence) was detected by agarose gel electrophoresis, the result showed that we obtained the specific positive band, though there were some non-specific bands under 1.0 kb (Fig. 3B). The synthetic DNA fragments with expected length were Gel extracted and sequenced.

      Figure 3.  Assembly of TTV genome nucleotides 78-2926 sequence (oligo pairs F2/R2-F38/R38). A: Strategies for the sequence synthesis. B: Gel electrophoresis' analyses of synthetic assembled intermediate. Lane 1, As many as 37 oligo pairs were assembled into intermediate 02-38(the 78-2926 sequence); 2, 1kb DNA marker from Fermentas (Burlington, Ontario, Canada)

      Assembly of the GC-rich (3612-3808 and 1-171) and the hairpin structure (2842-3646) sequences

      We designed a 150 base (R53) single-stranded DNA oligo and a 128 base (R42-43) single-stranded DNA oligo with 15-20 bases overlaps to adjacent oligos which contained the full-length GC-rich sequence and the hairpin structure sequence respectively, and assembled them with PCA into two cassettes. GC-rich and the hairpin structure cassettes of the correct sequence were assembled to produce 368 bp and 805 bp intermediates individually (Fig. 4A, 4C). The assembled intermediates 49-02 (3612-3808 and 1-171 sequence) and 38-49 (2842-3646 sequence) were detected by agarose gel electrophoresis, the result showed that we obtained a positive band of the estimated size (Fig. 4B, 4D). The synthetic DNA fragments with expected length (368 or 805 bp) were cloned and sequenced.

      Figure 4.  The GC-rich and the hairpin-structure sequences synthesis. A: Strategies for the GC-rich sequences (3612-3808 and 1-171) synthesis. B: Gel electrophoresis' analyses of the GC-rich sequences assembly reactions. Lane 1, Marker I from Dongsheng Biotech (Guangzhou); 2, As many as 4 oligo pairs (from F49/R49 to F02/R02) were assembled into intermediate 49-02(368bp). C: Strategies for the hairpin-structure sequences (2 842-3 646) synthesis. D: Gel electrophoresis' analyses of the hairpin-structure sequence assembly reactions. Lane 1, Marker I from Dongsheng Biotech; 2, As many as 11 ologo pairs (from F41/R41 to F49/R49) were assembled into intermediate 38-49(805bp)

      Assembly of 3.8 kb TTV full length genome

      The larger intermediates 02-38, 38-49, 49-02 were cloned in the pTA2 vector(TOYOBO) and verified by sequencing, then, these three fragments were assembled into a complete TTV genome (Fig. 5A). Gel electro-phoresis' results showed that a specific band of approximately 3.8 kb matched the expected size (Fig. 5B). The synthetic genome were cloned and sequenced. The 3.8 kb synthetic genome was successfully aligned to natural full length genome sequences using the online ClustalW Multiple alignment tool (http://www.ebi.ac.uk/Tools/msa/clustalw2/) indicating we successfully synthesized 3.8 kb TTV full length genome.

      Figure 5.  Strategy for the TTV genome synthesis and analyses. A: Strategy for the 3.8 kb TTV (SANBAN isolate) genome synthesis. B: Gel electrophoresis' analyses of entire synthetic TTV genome synthesis reactions. Lane 1, 5kb marker from TAKARA BIO (Otsu, Shiga, Japan); 2, The 3 intermediates (02-38, 38-49 and 49-02) were assembled into entire synthetic 3.8 kb TTV genome

    • Oligonucleotides assembly by PCA and double-strand DNA connection by SOEing, as described here, could be very useful in the synthesis of DNA fragments, including genes and genomes, less than 10kb. In fact, the principles behind both methods is similar, as they both require two-steps. On the first step, the templates are presented in approximately the same quantities will anneal with partial overlaps and extend, so that each becomes longer extensions. Then, the extension products can be amplified on the second reaction step.

      The assembly of a viral genome from synthetic oligos could be performed according to the protocols we have described here. The length of the oligos used for assembly is an important factor that influences error rates of the final products of DNA synthesis. There are fewer carry-over errors when shorter oligos are used, but total producing cost is more expensive. Xiong et al. considered that 60-base oligos provided a reasonable balance between low error rate and low cost [24], so we followed the principle in this study.

      The limits of oligos uptake and assembly have been explored. Stemmer et al. had assembled a 2.7 kb plasmid used 134 oligos in a single reaction[21]. But in our single reaction, the capacity to efficiently assemble into full-length cassettes was not more than five oligo pairs, and only approximately 400 bp assemblies were produced. In Stemmer's experiment, the assembled cycles of PCA reaction reached 55 and the working concentration of each oligo was less than 50 nM. In the future, the oligo uptake limits in our experiment can probably be improved with increasing the numbers of assembled cycles and diluting the oligo concentration.

      In most genomes of organisms, there are some gene-regulatory elements, including promoters, enhancers and other control elements, consisting of GC-rich regions [7]. Assemblies of these regions are essential in synthesis of entire genomes to maintain vital functions. DNA regions with GC-rich content are more prone to form secondary structures with high melting temperatures (Tm). In the case of GC-rich sequences, the single-stranded template may form intra-molecular stem loops during the initial cycles of amplification, which can stall the reaction. So, the longer oligos must be synthesized containing the whole-length GC-rich region, while homologous flanking sequences with low GC-content are also required. Nowadays oligos as long as 150-200 bp can be chemically synthesized by several biotechnological company, such as Integrated DNA Technologies. In order to improve the amplification efficiency of GC-rich targets, we utilized KOD-FX (TOYOBO) in the PCA reaction to assemble the GC-rich and the hairpin structure sequences, owing to its high fidelity, excellent elongation ability and ability to amplify of GC-rich target and crude samples. Furthermore, the annealing temperature (Ta) used during this reaction needed to reach at least 60℃.

      TTV genome is a single-stranded circular DNA, therefore, cyclization and revival of entire synthetic genome was carried out in our laboratory. This study demonstrates that entire viral genomes and synthons can be effectively assembled by the methods described here and provides a methodological basis for chemical synthesis of a viral genome for used as a live attenuated vaccine or gene therapy vector.

      Here we have successfully synthesized the 3.8 kb TTV genome containing a hairpin structure and a GC-rich region. However, such in vitro synthesis methods are adequate for generating DNAs up to several tens of kb in length. Application of synthetic technology in vitro and following Gibson's transformation-associated recombination (TAR) method in yeast [6], much larger genomes could be synthesized. We plan to design, assemble and clone genomes of cyanophage, such as Pf-WMP3 of 43 kb genome and Ma-LMM01 of 162 kb genome, which infect cyanobacterium Phormidium foveolarum and Microcystis aeruginosa respectively[12, 25]. The synthetic cyanophage could serve as potential algicide candidate against toxic cyanobacterium to control water bloom.

      Acknowledgements

      We thank Dr. Zhengli Shi, Dr. Zhihong Hu, Dr. Xinwen Chen and Dr. Simon Rayner of Wuhan Institute of Virology, Chinese Academy of Sciences, China, for their advice, encouragement and support in conducting this research project. This work was supported by the Knowledge Innovation Program of the Chinese Academy of Sciences, Grant No. KSCX2-EW-Z-3.

    Figure (5)  Reference (25) Relative (20)

    目录

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return