Mohammad Sadraeian, Mohammad Bagher Ghoshoon, Milad Mohkam, Zeinab Karimi, Sara Rasoul-Amini and Younes Ghasemi. Modification in Media Composition to Obtain Secretory Production of STxB-based Vaccines using Escherichia coli[J]. Virologica Sinica, 2013, 28(1): 43-48. doi: 10.1007/s12250-013-3286-9
Citation: Mohammad Sadraeian, Mohammad Bagher Ghoshoon, Milad Mohkam, Zeinab Karimi, Sara Rasoul-Amini, Younes Ghasemi. Modification in Media Composition to Obtain Secretory Production of STxB-based Vaccines using Escherichia coli .VIROLOGICA SINICA, 2013, 28(1) : 43-48.  http://dx.doi.org/10.1007/s12250-013-3286-9

Modification in Media Composition to Obtain Secretory Production of STxB-based Vaccines using Escherichia coli

cstr: 32224.14.s12250-013-3286-9
  • 通讯作者: Younes Ghasemi, ghasemiy@sums.ac.ir
  • 收稿日期: 2012-09-16
    录用日期: 2013-01-05
  • Shiga toxin B-subunit (STxB) from Shigella dysenteriae targets in vivo antigen to cancer cells, dendritic cells (DC) and B cells, which preferentially express the globotriaosylceramide (Gb3) receptor. This pivotal role has encouraged scientists to investigate fusing STxB with other clinical antigens. Due to the challenges of obtaining a functional soluble form of the recombinant STxB, such as formation of inclusion bodies during protein expression, scientists tend to combine STxB with vaccine candidates rather than using their genetically fused forms. In this work, we fused HPV16 E7 as a vaccine candidate to the recombinantly-produced STxB. To minimize the formation of inclusion bodies, we investigated a number of conditions during the expression procedure. Then various strategies were used in order to obtain high yield of soluble recombinant protein from E. coli which included the use of different host strains, reduction of cultivation temperature, as well as using different concentrations of IPTG and different additives (Glycin, Triton X-100, ZnCl2). Our study demonstrated the importance of optimizing incubation parameters for recombinant protein expression in E. coli; also showed that the secretion production can be achieved over the course of a few hours when using additives such as glycine and Triton X-100. Interestingly, it was shown that when the culture mediums were supplemented by additives, there was an inverse ratio between time of induction (TOI) and the level of secreted protein at lower temperatures. This study determines the optimal conditions for high yield soluble E7-STxB expression and subsequently facilitates reaching a functionally soluble form of STxB-based vaccines, which can be considered as a potent vaccine candidate for cervical cancer.

Modification in Media Composition to Obtain Secretory Production of STxB-based Vaccines using Escherichia coli

  • Corresponding author: Younes Ghasemi, ghasemiy@sums.ac.ir
  • Received Date: 16 September 2012
    Accepted Date: 05 January 2013

    Fund Project: Research Council of Shiraz University of Medical Sciences 91-01-36-4417

  • Shiga toxin B-subunit (STxB) from Shigella dysenteriae targets in vivo antigen to cancer cells, dendritic cells (DC) and B cells, which preferentially express the globotriaosylceramide (Gb3) receptor. This pivotal role has encouraged scientists to investigate fusing STxB with other clinical antigens. Due to the challenges of obtaining a functional soluble form of the recombinant STxB, such as formation of inclusion bodies during protein expression, scientists tend to combine STxB with vaccine candidates rather than using their genetically fused forms. In this work, we fused HPV16 E7 as a vaccine candidate to the recombinantly-produced STxB. To minimize the formation of inclusion bodies, we investigated a number of conditions during the expression procedure. Then various strategies were used in order to obtain high yield of soluble recombinant protein from E. coli which included the use of different host strains, reduction of cultivation temperature, as well as using different concentrations of IPTG and different additives (Glycin, Triton X-100, ZnCl2). Our study demonstrated the importance of optimizing incubation parameters for recombinant protein expression in E. coli; also showed that the secretion production can be achieved over the course of a few hours when using additives such as glycine and Triton X-100. Interestingly, it was shown that when the culture mediums were supplemented by additives, there was an inverse ratio between time of induction (TOI) and the level of secreted protein at lower temperatures. This study determines the optimal conditions for high yield soluble E7-STxB expression and subsequently facilitates reaching a functionally soluble form of STxB-based vaccines, which can be considered as a potent vaccine candidate for cervical cancer.

  • 加载中
    1. Baneyx F and Mujacic M. 2004. Recombinant protein folding and misfolding in Escherichia coli. Nat Biotechnol, 22: 1399-1408.
        doi: 10.1038/nbt1029

    2. Buchner J, Pastan I and Brinkmann U. 1992. A method for increasing the yield of properly folded recombinant fusion proteins: single-chain immunotoxins from renaturation of bacterial inclusion bodies. Anal Biochem, 205: 263-270.
        doi: 10.1016/0003-2697(92)90433-8

    3. Choi J H and Lee S Y. 2004. Secretory and extracellular production of recombinant proteins using Escherichia coli. Appl Microbiol Biotechnol, 64: 625-635.
        doi: 10.1007/s00253-004-1559-9

    4. Choi N W, Estes M K and Langridge W H R. 2005. Oral immunization with a shiga toxin B subunit: Rotavirus NSP4(90) fusion protein protects mice against gastroenteritis. Vaccine, 23: 5168-5176.
        doi: 10.1016/j.vaccine.2005.06.015

    5. Goncalves A N, Meschiari C A, Stetler-Stevenson W G, Nonato M C, Alves C P, Espreafico E M and Gerlach R F. 2012. Expression of soluble and functional full-length human Matrix Metalloproteinase-2 in Escherichia coli. J Biotechnol 157: 20-24.
        doi: 10.1016/j.jbiotec.2011.09.030

    6. Haicheur N, Bismuth E, Bosset S, Adotevi O, Warnier G, Lacabanne V, Regnault A, Desaymard C, Amigorena S and Ricciardi-Castagnoli P. 2000. The B subunit of Shiga toxin fused to a tumor antigen elicits CTL and targets dendritic cells to allow MHC class Ⅰ-restricted presentation of peptides derived from exogenous antigens. J Immunol, 165: 3301-3309.
        doi: 10.4049/jimmunol.165.6.3301

    7. Haicheur N, Benchetrit F, Amessou M, Leclerc C, Falguires T, Fayolle C, Bismuth E, Fridman W H, Johannes L and Tartour E. 2003. The B subunit of Shiga toxin coupled to full-size antigenic protein elicits humoral and cell-mediated immune responses associated with a Th1 dominant polarization. Int immunol, 15: 1161-1171.
        doi: 10.1093/intimm/dxg118

    8. Han L, Doverskog M, Enfors S O and Häggström L. 2002. Effect of glycine on the cell yield and growth rate of Escherichia coli: evidence for cell-density-dependent glycine degradation as determined by 13C NMR spectroscopy. J Biotechnol, 92: 237-249.
        doi: 10.1016/S0168-1656(01)00373-X

    9. Humphreys D P, Sehdev M, Chapman A P, Ganesh R, Smith B J, King L M, Glover D J, Reeks D G and Stephens P E. 2000. High-level periplasmic expression in Escherichia coli using a eukaryotic signal peptide: importance of codon usage at the 5'end of the coding sequence. Protein Expr Purif, 20: 252-264.
        doi: 10.1006/prep.2000.1286

    10. Janssen K P, Vignjevic D, Boisgard R, Falguires T, Bousquet G, Decaudin D, Dolli F, Louvard D, Tavitian B and Robine S. 2006. In vivo tumor targeting using a novel intestinal pathogen-based delivery approach. Cancer Res, 66: 7230-7237.
        doi: 10.1158/0008-5472.CAN-06-0631

    11. LaCasse E C, Saleh M T, Patterson B, Minden M D and Gariepy J. 1996. Shiga-like toxin purges human lymphoma from bone marrow of severe combined immunodeficient mice. Blood, 88: 1561-1567.

    12. Lee R S, Tartour E, Van der Bruggen P, Vantomme V, Joyeux I, Goud B, Fridman W H and Johannes L. 1998. Major histocompatibility complex class Ⅰ presentation of exogenous soluble tumor antigen fused to the B-fragment of Shiga toxin. Eur J Immunol, 28: 2726-2737
        doi: 10.1002/(ISSN)1521-4141

    13. Li J, Liu J, Lan X, Cheng J, Wu R, Lou Z Z, Yin X, Li X, Li B and Yang B. 2009. Cloning the structure genes and expression the N gene of porcine epidemic diarrhea virus DX. Virol Sin, 24: 179-186.
        doi: 10.1007/s12250-009-2982-y

    14. Li Y L, Liu J, Liu J N and Zhang J. 2011. Immunization of protein HPV16 E7 in fusion with mouse HSP70 inhibits the growth of TC-1 cells in tumor bearing mice. Vaccine, 29: 5959-5962.
        doi: 10.1016/j.vaccine.2011.06.046

    15. Nakagawa I, Nakata M, Kawabata S and Hamada S. 1999. Regulated expression of the Shiga toxin B gene induces apoptosis in mammalian fibroblastic cells. Mol Microbiol, 33: 1190-1199.

    16. Ni Y and Chen R. 2009. Extracellular recombinant protein production from Escherichia coli. Biotechnol Lett, 31: 1661-1670.
        doi: 10.1007/s10529-009-0077-3

    17. O'Brien A D, Tesh V L, Donohue-Rolfe A, Jackson M P, Olsnes S, Sandvig K, Lindberg A A and Keusch G T. 1992. Shiga toxin: biochemistry, genetics, mode of action and role in pathogenesis. Curr Top Microbiol Immunol, 180: 65-94.

    18. Ohmura M, Yamamoto M, Tomiyama-Miyaji C, Yuki Y, Takeda Y and Kiyono H. 2005. Nontoxic Shiga toxin derivatives from Escherichia coli possess adjuvant activity for the augmentation of antigen-specific immune responses via dendritic cell activation. Infect Immu, 73: 4088-4097.
        doi: 10.1128/IAI.73.7.4088-4097.2005

    19. Sadraeian M, Honari H, Madanchi H and Hesaraki M. 2011. Cloning and Expression of CtxB-StxB in Esherichia coli: A challenge for Improvement of Immune Response Against StxB. Iran J Pharm Sci, 7: 185-190.

    20. Sedighzadeh S S, Shamsara M and Shahpiri A. 2012. Fusion Protein Strategy to Increase Expression and Solubility of Hypervariable Region of VP2 Protein of Infectious Bursal Disease Virus in Escherichia coli. Prot J: 1-5.

    21. Shaw C A and Starnbach M N. 2003. Using modified bacterial toxins to deliver vaccine antigens. ASM News, 69: 384-389.

    22. Vingert B, Adotevi O, Patin D, Jung S, Shrikant P, Freyburger L, Eppolito C, Sapoznikov A, Amessou M and Quintin-Colonna F. 2006. The Shiga toxin B-subunit targets antigen in vivo to dendritic cells and elicits anti-tumor immunity. Eur J Immunol, 36: 1124-1135.
        doi: 10.1002/(ISSN)1521-4141

    23. Wang P, Song P, Li X, Su R R, Wang H and Zhu G P. 2012. Study on soluble e xpression of g lutamate d ehydrogenase from t ea p lant in Escherichia coli using fusion tags. African J Biotechnol, 11: 6241-6250.

    24. Weikert C, Sauer U and Bailey J E. 1998. An Escherichia coli host strain useful for efficient overproduction of secreted recombinant protein. Biotechnol Bioeng 59: 386-391.
        doi: 10.1002/(ISSN)1097-0290

    25. Yang J, Moyana T, MacKenzie S, Xia Q and Xiang J. 1998. One Hundred Seventy-Fold Increase in Excretion of an FV Fragment-Tumor Necrosis Factor Alpha Fusion Protein (sFV/TNF-α) from Escherichia coli Caused by the Synergistic Effects of Glycine and Triton X-100. Appl Environ Microbiol, 64: 2869-2874.

    26. Zhang S, Fan R, Yang T, Sun Y, Li J, Xu Q and Zhou P. 2009. An improved strategy for efficient expression and purification of soluble HIV-1 tat protein in E. coli. Virol Sin, 24: 518-528
        doi: 10.1007/s12250-009-3068-6

  • 加载中

Figures(3) / Tables(1)

Article Metrics

Article views(6024) PDF downloads(15) Cited by(0)

Related
Proportional views
    通讯作者: 陈斌, bchen63@163.com
    • 1. 

      沈阳化工大学材料科学与工程学院 沈阳 110142

    1. 本站搜索
    2. 百度学术搜索
    3. 万方数据库搜索
    4. CNKI搜索

    Modification in Media Composition to Obtain Secretory Production of STxB-based Vaccines using Escherichia coli

      Corresponding author: Younes Ghasemi, ghasemiy@sums.ac.ir
    • 1. Pharmaceutical Sciences Research Center, Shiraz University of Medical Sciences, Shiraz, P.O. Box 71345-1583, Iran
    • 2. Department of Pharmaceutical Biotechnology School of Pharmacy, Shiraz University of Medical Science, Shiraz, P.O. Box 71345-1583, Iran
    • 3. Department of Medicinal Chemistry, School of Pharmacy, Shiraz University of Medical Sciences, Shiraz, P.O. Box 71345-1583, Iran
    Fund Project:  Research Council of Shiraz University of Medical Sciences 91-01-36-4417

    Abstract: Shiga toxin B-subunit (STxB) from Shigella dysenteriae targets in vivo antigen to cancer cells, dendritic cells (DC) and B cells, which preferentially express the globotriaosylceramide (Gb3) receptor. This pivotal role has encouraged scientists to investigate fusing STxB with other clinical antigens. Due to the challenges of obtaining a functional soluble form of the recombinant STxB, such as formation of inclusion bodies during protein expression, scientists tend to combine STxB with vaccine candidates rather than using their genetically fused forms. In this work, we fused HPV16 E7 as a vaccine candidate to the recombinantly-produced STxB. To minimize the formation of inclusion bodies, we investigated a number of conditions during the expression procedure. Then various strategies were used in order to obtain high yield of soluble recombinant protein from E. coli which included the use of different host strains, reduction of cultivation temperature, as well as using different concentrations of IPTG and different additives (Glycin, Triton X-100, ZnCl2). Our study demonstrated the importance of optimizing incubation parameters for recombinant protein expression in E. coli; also showed that the secretion production can be achieved over the course of a few hours when using additives such as glycine and Triton X-100. Interestingly, it was shown that when the culture mediums were supplemented by additives, there was an inverse ratio between time of induction (TOI) and the level of secreted protein at lower temperatures. This study determines the optimal conditions for high yield soluble E7-STxB expression and subsequently facilitates reaching a functionally soluble form of STxB-based vaccines, which can be considered as a potent vaccine candidate for cervical cancer.

    • The nontoxic B subunit of Shiga toxin (STxB) from Shigella dysenteriae (O'Brien A D, et al., 1992; Shaw C A, et al., 2003) is responsible for toxin binding and internalization into target cells by interacting with glycosphingolipid globotriaosyl ceramide (Gb3 or CD77) (Haicheur N, et al., 2003; Janssen K P, et al., 2006; LaCasse E C, et al., 1996). Gb3 is almost exclusively expressed in cancer cells, dendritic cells (DC) and B cells. So it is tempting to propose the use of STxB for activation of the MHC class Ⅰ-restricted E7-specific CTLs which have been shown to represent an important component of the protective and therapeutic immune response to tumors (Haicheur N, et al., 2000; Haicheur N, et al., 2003; Janssen K P, et al., 2006; Vingert B, et al., 2006). Genetic fusions of STxB with defined viral/tumor antigens have previously been incorporated in recombinant therapeutic vaccines (Choi N W, et al., 2005; Haicheur N, et al., 2000; Lee R S, et al., 1998; Nakagawa I, et al., 1999; Ohmura M, et al., 2005; Vingert B, et al., 2006). Due to the presence of certain barriers in obtaining a functionally soluble form of the recombinant STxB, scientists tend to combine STxB with vaccine candidates rather than use their genetically fused forms. However, in most cases, such peptides failed to elicit efficient immune and clinical responses (Goncalves A N, et al., 2012).

      Bacteria can express the recombinant protein in insoluble or soluble forms. The former is expressed in the cytoplasm as an inclusion body with high-level protein production. (Lee R S, et al., 1998), although this high yield of heterologous protein expression may be nonfunctional and hence the tumor targeting ability of STxB will not be fulfilled (Buchner J, et al., 1992). Furthermore, due to the exposure of hydrophobic peptide regions, proteins are mainly aggregated (Sedighzadeh S S, et al., 2012; Weikert C, et al., 1998; Zhang S, et al., 2009).

      In previous studies, in order to obtain soluble proteins from E. coli, several strategies have been applied, e.g. optimization of medium formulation and parameters of the cultivation process (Baneyx F, et al., 2004; Choi J H, et al., 2004; Li J, et al., 2009), application of fusion tags, coexpression of chaperones (Weikert C, et al., 1998), secretion of recombinant proteins into the periplasmic space and also modification of culture medium to incorporate diverse helper proteins and additives (Choi J H, et al., 2004).

      In this study, we chose Human papillomavirus 16 (HPV16) E7 oncogene as a model antigen for a protein-based therapeutic vaccine against cervical cancer. Previous studies have showed that the immunization with HPV16 E7 protein in fusion form with certain immunoadjuvants is able to elicit specific protective immunity against TC-1 tumor growth (Lee R S, et al., 1998; Li Y L, et al., 2011). However, to date, there has not been any report about development of a protein vaccine using the whole HPV16 E7 protein fused to STxB.

      In this work HPV16 E7 antigen was fused with STxB to function as a bacterial drug delivery system. Then various strategies including the use of different host strains, reduction of cultivation temperature, different concentrations of IPTG and different additives (Glycin, Triton X-100, ZnCl2), were used in order to obtain high yield of secreted recombinant protein from E. coli. We also investigated the effect of these parameters for export of recombinant protein to the growth medium. Finally, we developed a new merged strategy, involving less expensive and fewer steps, to obtain high-yield protein expression. The results of this study will facilitate achieving a functional soluble form of STxB-based vaccines.

    • Pfu and taq DNA polymerase (2.5 U/μL, Fermentas, Lithuania), Enzymes Nde Ⅰ, Sal Ⅰ and Not Ⅰ (Fermentas, Lithuania.), IPTG (Vivantis, Malaysia), Vector pET-28a(+) (Novagen USA), Vector pGEM-T (Promega, USA), and the stxB gene from Shigella dysenteriae type Ⅰ was prepared (At Imam Hossein University, Tehran, Iran) according to the method we previously described Sadraeian M, et al., 2011), and was used as the PCR template. E. coli DH5α and E. coli BL21 (DE3) were used for cloning and expression experiments. Plasmid pGEM-T Vector and pET-28a(+) were used as cloning and expression vectors respectively.

    • First step: The DNA sequence of the E7 gene was obtained from the GenBank database (accession no. AF486352) and confirmed by sequencing. Optimization of the rare codons of the E7 gene was performed using the JCAT (Java Codon Adaptation Tool) software to increase the soluble expression of E7 protein in the host E. coli BL21 (DE3). Synthetic codon optimized HPV16 E7 was cloned into pGH Vector purchased from Nedayefan Co, Iran. In this case, only the forward primer of HPV16 E7 with an Nde Ⅰ restriction site as well as signal sequence at 5' end was designed; Forward primer (HPV E7): CATATGATGAAGAAGACCGCAATCGCAATC Second step: The stxB gene (207 bp) from Shigella dysenteriae type Ⅰ was amplified from plasmid by PCR. The following oligonucleotides with Sal Ⅰ, BamH Ⅰ and Not Ⅰ restriction sites were used: Forward primer(stxB): 5′GGATCCGGCGGCGGCGGCTCTGTCGACACGCCTGATTGTGTAACTG3′. Reverse primer (stxB): ′GCGGCCGCCTAGTGGTGGTGGTGGTGGTGGTGCTCGAGTATTATCAACGAAAAATAACTTC3′. GGCGGCGGCGGCTCT is the gene codon of a nonfurin linker that is rich in glycine and serine amino acids. Here restriction sites are underlined. The stxB gene was amplified with PCR by pfu enzyme.

      Third step: The PCR product of stxB was tailed with dATP, separately ligated with pGEM-E7 vector which was digested with Nde Ⅰ and BamH Ⅰ, and transformed into E. coli DH5α. Construction of pGEM E7-Linker-stxB was subsequently tested by PCR as a control test and endonuclease digestion. The insert was verified by DNA sequencing.

      The reverse primer contained a 6×His tag at the C-terminus of the recombinant protein for the convenience of purification and Western blot detection of the recombinant protein.

    • The E7-stxB fragment was produced by digestion of pGEM E7-stxB by NdeⅠ and NotⅠ restriction endonuclease and was subcloned into undigested pET28a(+) as an expression vector to construct pET28a(+)-E7-stxB. Afterward pET-28a(+)-E7-stxB was confirmed by PCR and restriction enzyme digestion.

      The recombinant plasmid was amplified in competent E. coli DH5α and then extracted by the alkaline lysis method (Sedighzadeh S S, et al., 2012) and stored at -20℃. The resulting plasmid was transformed via electroporation into the competent final host, E. coli BL21 (DE3), then kanamycin resistance as well as restriction enzyme digestion were used for selection and confirmation. For the sequencing of the inserted fragment, 20 μL of purified recombinant plasmid was sequenced by Nedayefan Co, Iran.

    • For optimization of protein production, various parameters were examined:supplementation of the medium at different temperatures (20, 30 and 37℃), induction with IPTG (isopropyl- -D-thiogalactoside) at concentrations ranging from 0.5 to 1 mmol/L. To find the optimal post induction time to harvest the cells, the progress of expression was followed by taking samples of the culture at different time points after induction (Table 1). The samples were analyzed directly by SDS-PAGE in order to achieve optimized conditions for expression with the pET-28a(+)-E7-stxB vector using E. coli BL21(DE3). This protocol included the following steps: Freshly transformed bacteria were grown overnight at 37℃ in 30 mL of 2X YT (Luria Broth (LB) medium with 2X yeast extract) medium containing kanamycin (40 μg/mL). The expression culture was inoculated with overnight culture in 1.5 L of 2X YT medium and grown at 37℃ with constant agitation at 220 rpm until the optical density at 600 nm reached 0.6 (OD600=0.6). The production of recombinant protein was induced by addition of IPTG to final concentrations of 0.5, 0.7 and 1 mmol/L. The cultures were allowed to grow for additional times of 3, 5 or 16 h and also at different temperatures (20, 30 and 37℃) (Table 1). The cells were harvested by centrifugation at 7085 rpm for 30 min and the cell pellet was stored at -20℃ until used for protein purification. Approximately 10 g (wet weight) of cells were obtained from 1.5 L of bacterial culture. Samples were subjected to SDS-PAGE and visualized by staining with Coomassie Brilliant Blue.

      Condition label IPTG
      (mmol/L)
      Time of Induction
      (h)
      Temperature
      (℃)
      Soluble recombinant protein yield* (%)
      1 1 5 37 36
      2 0.5 13 37 32
      3 0.7 22 30 31
      4 0.5 22 37 29
      5 0.7 13 30 33
      6 1 5 22 22
      7 1 22 22 34
      * The percentage of soluble recombinant protein yield of total cell protein.

      Table 1.  Different induction conditions based on various parameters for optimization of protein production

    • Consistent with the previous protocol, the culture medium was supplemented with 10 μmol/L of ZnCl2, whereas the secretion of periplasmic proteins into the medium was stimulated by addition of 2% glycine and 1% Triton X-100 to the growth medium. This protocol included the following steps: Firstly, each supplemented medium was cultivated at 37℃ with constant agitation at 220 rpm until the optical density at 600 nm reached 0.6 (OD600=0.6). Then IPTG was added to final concentrations of 0.5, 0.7 and 1 mmol/L of the culture medium (Table 1). Afterwards, 2% glycine and 1% Triton X-100 were added to the culture medium when the optical density at 600 nm reached 4. The cultures were allowed to grow for additional times at the different temperatures listed above (Table 1). Finally, supernatant and cell debris were harvested by centrifugation at 7085 rpm for 30 min.

    • In each step, samples were analyzed by SDS–PAGE in a gel containing 12% (w/v) polyacrylamide under reducing conditions, followed by staining with Coomassie brilliant blue or Western blotting.

      For Western blot analysis, non-stained SDS-PAGE gels were transferred to nitrocellulose membranes by electroblotting (Schleicher and Schuell BioScience, Dassel, Germany). The membranes were blocked for 1 h at room temperature in PBS (phosphate-buffered saline; 80 mmol/L Na2HPO4, 20 mmol/L KH2PO4, 137 mmol/L NaCl, 2. 7 mmol/L KCl, pH 7.4) containing 5% nonfat skim milk (Carl Roth, Karlsruhe, Germany). Then the membrane was incubated with rabbit anti His-tag polyclonal antibody against E7-STxB-His6 at 1:1000 dilution in PBS containing 0.1% Tween 20 (PBS-T), followed by a second incubation step with horseradish peroxidase-conjugated anti-mouse total IgG from rabbit (Sigma–Aldrich). Immunoreactivity was detected with diaminobenzidine (DAB) as a chromogenic substrate (Li Y L, et al., 2011).

    • Western blot analysis was performed for purified recombinant proteins. The intensity of Western blot was quantified by scanning densitometry (with TIFF or JPG formats) using the Image J analysis software package (NIH, USA).

    • For concentration of recombinant protein, the harvested supernatant was concentrated to 50 times by ultra filtration. The histidine-tagged E7-STxB protein was purified using a His-SelectTM Nickel Affinity Gel (3 mL; Sigma) following the manufacturer's standard procedures.

    • The produced construct, pET28a(+)-E7-STxB, was confirmed by 3 methods; First, by restriction enzyme analysis, then by PCR reaction of extracted vectors and finally by sequencing of the inserted fragment. All results confirmed an in-frame fusion of the construct. The PCR product of recombinant vector pET-28a(+)-E7-STxB was analyzed by agarose gel electrophoresis. BLAST searches of the fused protein sequence showed 100% identity at the amino acid sequence level with HPV16 E7 and shigella toxin B.

    • The predicted molecular weight of the expressed protein from sequence E7/STxB was 28 kDa. In preliminary experiments, the inductions were performed according to conditions shown in Table 1 (without additives). The pellet and supernatant fractions were tested. At first, via the SDS-PAGE analysis of early supernatant, we did not observe any secreted protein. After centrifugation of pellets which were resuspended in lysis buffer, secondary supernatants were reanalysed and the expected band around 28 kDa was observed. By comparing the gels, the best induction conditions to reach soluble protein were estimated to be as follows: 22 h after induction at 22℃, IPTG was added to a final concentration of 1 mmol/L and also at 5 h after induction at 37℃, with IPTG to a final concentration of 1 mmol/L (Fig. 1).

      Figure 1.  SDS-PAGE analysis of E7-STxB expression in E. coli BL21 (DE3) under different induction conditions A: 22 h after induction at 22℃. B: 5 h after induction at 37℃. C, soluble lysate of cells expressing recombinant plasmid before IPTG induction; P, pellet fractions of cells expressing recombinant plasmid after IPTG induction; S1, supernatant fractions of cells expressing recombinant plasmid after IPTG induction as secreted proteins; S2, soluble lysate of cells expressing recombinant plasmid after IPTG induction.

    • After addition of Triton X-100 and glycine to the culture medium at an OD600 of about 4, similar optimization conditions were observed for secretion of E7-STxB into the culture medium: 22 h after induction at 22℃ IPTG was added to a final concentration of 1 mmol/L. In contrast, under conditions of 5 h after induction at 37℃, very low level of secreted recombinant protein expression was observed (Fig. 2). Subsequent purification of secreted protein was straightforward. The E7/STxB protein, presented a molecular weight of approximately 28 kDa with only one band on SDS-PAGE.

      Figure 2.  SDS-PAGE analysis of E7-STxB expression in E. coli BL21 (DE3) under different induction conditions using additives; lane P, pellet fractions of cells expressing recombinant plasmid 22 h after IPTG induction at 22℃; lane A, supernatant fractions of cells expressing recombinant plasmid after 22 h induction at 22℃; lane B, supernatant fractions of cells expressing recombinant plasmid after 5 h induction at 37℃; lane M, protein molecular marker; lane C, soluble lysate of cells expressing recombinant plasmid before IPTG induction.

    • The purified proteins under optimized conditions were confirmed by Western blot assay. As shown in figure 3, fractions containing His-tagged protein are recognized by an antibody directed against E7-STxB-His6. The expressed protein appeared as the predominant band at 28 kDa.

      Figure 3.  Western blot analysis of secreted E7-STxB-His6 into supernatant. M: protein molecular marker; A: Soluble lysate of cells without recombinant plasmid as negative control; B: 5 h induction at 37℃; C: 22 h induction at 22℃.

      The concentration of purified soluble protein was quantified by subtracting normalized background values obtained from the pixel densities of bands corresponding to endogenous proteins. The intensity of optimized bands was measured to be > 6.2 times greater than other bands.

    • This study describes a method for the optimization of soluble protein expression from a STxB-based vaccine in E. coli by applying protocol modifications in the form of media composition and culture conditions. The presence of inclusion bodies (IBs) in the periplasm is found to interfere with proper folding of the protein. Therefore, the secretion of protein into the supernatant may increase protein folding efficiency (Goncalves A N, et al., 2012). In this study, the ompA signal sequence has been used for translocation of recombinant protein to the periplasm for probable secretion into the growth medium. In spite of obtaining expressed E7-STxB that is soluble in a lysate of cells at the early optimization (Fig. 1), we did not observe secreted E7-STxB in the culture medium. In order to obtain a STxB-based vaccine with capability in tumor targeting (Haicheur N, et al., 2003; Janssen K P, et al., 2006; LaCasse E C, et al., 1996; Ohmura M, et al., 2005), devising a method to achieve a soluble form of the protein is necessary. We know that the host cell's capability to express the protein in a soluble fraction can be affected by a number of factors leading to the formation of soluble protein (Han L, et al., 2002; Sadraeian M, et al., 2011; Yang J, et al., 1998). These factors include:

    • Depending on whether the protein is eukaryotic or prokaryotic, the choice of a suitable host strain (herein E. coli BL21 (DE3)) as well as an appropriate signal sequence (ompA signal), can improve the chance of achieving a high yield of heterologous protein, provided that the recombinant protein is compatible with E. coli expression and folding mechanisms (Humphreys D P, et al., 2000; Ni Y, et al., 2009). In our approach, to further increase the expression level of the HPV16 E7 protein, we optimized the E7-coding sequence for the host strain.

    • According to previous reports, synergic addition of glycine and ZnCl2 is able to stabilize the membrane and prevent bacteriolysis. (Humphreys D P, et al., 2000). In this work, as Glycine and Triton X-100 were able to change morphology, causing the disruption of cell membrane integrity of E. coli, they were appropriate for releasing of recombinant proteins into the culture medium. Hence, by using lysis buffer, we confirmed the association effects of both substances on the solubility of E7-STxB.

    • Screening under the identified expression conditions caused a greater than six-fold improvement in the yield of soluble expression (Fig. 1). Subsequently, the supplemented media with additives (2% glycine and 1% Triton X-100) had greater than seven-fold improvement in the secreted production of E7-STxB (Fig. 2). We also showed that the expression at low temperatures (up to 22℃) for extended periods (up to 22 hours) led to improve the secretion of recombinant protein into the medium.

    • This study demonstrates the importance of optimizing incubation parameters for recombinant protein expression in E. coli. It also shows that secretion production can be achieved over several hours when using additives such as glycine and Triton X-100. In fact, when the culture mediums were supplemented by additives, there was an inverse ratio between time of induction (TOI) and secreted protein level at lower temperatures (data not shown). The key to the success of this investigation was the ability to design a combined study in which we were able to co-modify both media composition and culture conditions. In this way, our study determined the optimal conditions for high yield soluble E7-STxB expression and subsequently facilitates achieving a functional soluble form of the protein for STxB-based vaccines.

    Figure (3)  Table (1) Reference (26) Relative (20)

    目录

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return