HTML
-
A total of 600 nasal swabs were collected from a slaughterhouse during a surveillance of swine influenza in Anhui Province in 2017 (Fig. 1). Each of the nasal swabs was immersed in 1.5 mL sterile phosphate buffer saline (PBS), and half of the solution was used to detect the swine influenza virus. The remaining approximately 0.8 mL was pooled into one sample for virome analysis. Specimen processing and viral nucleic acid library preparation were performed as previously described (Shan et al. 2011). Briefly, the mixed samples were centrifuged at 13, 000 × g for 20 min to remove impurities and filtered through 0.45-μm- and 0.22-μm-filter membranes. The pellet was dipped in PBS overnight after ultracentrifugation at 160, 000 ×g for 4 h at 4 ℃ (Optima XPN-100 Ultracentrifuge, Beckman Coulter, Krefeld, Germany). The precipitates were repeatedly blended and dissolved in PBS. To remove the exogenous nucleic acid contamination, the sample was treated with DNase I and RNase I. Viral DNA/RNA was extracted from samples using EasyPure Viral DNA/RNA kit (TransGen, Beijing, China). Random PCR program was performed as follows. The first strand cDNA was synthesized with random primer of K9N: 5′-GACCATCTAGCGACCTCCCANNNNNNNNN-3′ and PrimeScript II RTase (Takara, Dalian, China) at 42 ℃ for 3 h, and then inactivated at 95 ℃ for 5 min. The second strand cDNA was synthesized with DNA Polymersae I Large (Klenow) Fragment (Promega, Madison, Wisconsin, USA) at 37 ℃ for 3 h, and then inactivated at 75 ℃ for 10 min. The DNA/cDNA was then amplified in a total reaction volume of 50 μL, which included 2 × KOD FX Neo buffer, 0.5 mmol/L each dNTP, 5 μL nucleotide, 10 mmol/L random primer of K9 (GACCATCTAGCGACCTCCCA) and 1 U KOD FX Neo DNA polymerase (Toyobo, Osaka, Japan). Finally, amplification was performed with 1 cycle of 94 ℃ for 2 min, followed by 40 cycles of 10 s at 98 ℃, 30 s at 55 ℃ and 2 min at 68 ℃. The PCR products were assessed by agarose gel electrophoresis. A total weight of 6 μg of random PCR products was submitted to Shanghai Personalbio Company and sequenced by Illumina HiSeq.
-
Raw read data generated by Illumina sequencing were analyzed on a local viral metagenomic analysis platform. Briefly, the resulting reads were analyzed using the FastQC program (Brown et al. 2017) and the Cutadapt (Martin 2011) software to obtain clean data and were then assembled into contigs using the MEGAHIT software (Li et al. 2016) with default settings. The assembled contigs were noted by BLASTn (Zhang et al. 2000) with a cut-off E-value of 10−5 against a complete genome sequence database of all known viruses. We counted 12 contigs that showed high nucleotide sequence similarities with FSfaCV (Table 1).
Contig no. Length (nt) Description Accession no. E-value Contig 277591 2774 FSfaCV isolate as50 KF246569 0 Contig 430548 2406 FSfaCV isolate as50 KF246569 0 Contig 24164 1041 FSfaCV isolate as50 KF246569 0 Contig 113448 961 FSfaCV isolate as50 KF246569 1.21E−163 Contig 5645 546 FSfaCV isolate as50 KF246569 2.70E−88 Contig 15591 1105 FSfaCV isolate as50 KF246569 2.70E−61 Contig 41875 398 FSfaCV isolate as50 KF246569 7.41E−43 Contig 170989 996 FSfaCV isolate as50 KF246569 3.21E−45 Contig 355689 342 FSfaCV isolate as50 KF246569 1.26E−94 Contig 142897 466 FSfaCV isolate as50 KF246569 1.08E−76 Contig 263359 334 FSfaCV isolate as50 KF246569 1.93E−137 Contig 87283 404 FSfaCV isolate as50 KF246569 6.92E−103 Contig 277591 2774 FSfaCV isolate JPN1 LC133373 0 Contig 430548 2406 FSfaCV isolate JPN1 LC133373 1.10E−172 Contig 24164 1041 FSfaCV isolate JPN1 LC133373 0 Contig 113448 961 FSfaCV isolate JPN1 LC133373 5.68E−157 Contig 5645 546 FSfaCV isolate JPN1 LC133373 5.75E−95 Contig 15591 1105 FSfaCV isolate JPN1 LC133373 1.25E−59 Contig 142897 466 FSfaCV isolate JPN1 LC133373 3.68E−111 Contig 355689 342 FSfaCV isolate JPN1 LC133373 1.27E−89 Contig 263359 334 FSfaCV isolate JPN1 LC133373 9.30E−111 Table 1. Contigs noted to belong to the genome of FSfaCVs.
-
Based on the multiple sequence alignment results, we found that a gap region (approximately 2600–2780 nt) existed in the longest contig (contig 277591) compared to the genome sequence of the FSfaCV isolate as50. Therefore, overlapping PCR was performed to obtain the full-length genome of the virus. Briefly, a pair of primers (FSfaCV-F: 5′-CCAGTATGTTTTCCGATTG-3′; FSfaCV-R: 5′-CGCTTGTCCCTTATGTCTT-3′) were designed to amplify a 585-bp-long segment (containing part of the Rep and 5′-end intergenic region) in the FSfaCV genome, which completely covered the missing sequence of the contigs. The reaction was carried out in a 50-μL mixture including 25 μL of 2 × Taq PCR StarMix (GenStar), 2 μL of each primer (10 μmol/L), 2 μL of DNA template, and 19 μL of sterile water. The optimal PCR amplification procedure consisted of pre-denaturation at 95 ℃ for 2 min, followed by 40 cycles of denaturation at 98 ℃ for 10 s, annealing at 55 ℃ for 30 s, and extension at 72 ℃ for 40 s, followed by a final extension at 72 ℃ for 10 min. The PCR products were subjected to agarose gel electrophoresis (1.2%) in TAE buffer. The full-length genome sequence obtained was designated as FSfaCV-CHN. The genome sequence was deposited in the GenBank database under the accession number MK462122.
-
To confirm the viral metagenomic analysis results, a retrospective survey of FSfaCV prevalence in pigs in the Anhui Province was conducted. A total of 197 samples, consisting of 79 serum samples, 88 nasal swab samples, and 30 tissue samples (mixture of lymph node and spleen) were collected from clinically healthy pigs in three cities (Lu'an, Anqing, and Chuzhou) (Fig. 1). The details of the samples are shown in Table 2. The viral DNA was extracted from the samples using EasyPure Viral DNA/RNA kit (TransGen, Beijing). Gene segments of FSfaCV were then detected using the above-mentioned overlapping PCR method. Briefly, the reaction was carried out in a 20-μL mixture including 10 μL of 2 × Taq PCR StarMix (GenStar), 1 μL of each primer (10 μmol/L), 1 μL of DNA template, and 6 μL of sterile water. The optimal PCR amplification procedure was performed with three-step cycles as mentioned above. The PCR products were subjected to agarose gel electrophoresis (1.2%) in TAE buffer. From the FSfaCV-positive samples, 11 gene segments were cloned into the pMD18-T vector. These included seven serum samples—collected from Lu'an and Anqing—two nasal swab samples—collected from Lu'an—and two tissue samples collected from Chuzhou. Each ligation mixture was transformed into Escherichia coli DH5α competent cells and positive clones, with appropriate inserts being screened by colony PCR and subsequently sequenced by Kumei Comate Bioscience Co., Ltd. All of the gene fragments generated in this study were deposited in the GenBank database under the accession numbers MK462123–MK462133.
City location Source Sample type Prevalence (%, positive/total) Lu'an Slaughterhouse A Serum 30.0 (15/50) Nasal swab 52.3 (46/88) Anqing Farm A Serum 100.0 (20/20) Farm B Serum 100.0 (9/9) Chuzhou Slaughterhouse B Lymph node and spleen 81.3 (13/16) Slaughterhouse C Lymph node and spleen 57.1 (8/14) Total 56.4 (111/197) Table 2. The FSfaCV prevalence in pigs in 2017 of Anhui Province.
-
The genome organization of the FSfaCV-CHN was generated using SeqBuilder software in the DNASTAR package (DNASTAR, Madison, WI, USA). The stem-loop structures were detected using the DNA folding prediction software Mfold (Zuker 2003). Open reading frames (ORFs) in the full genome of FSfaCV were identified using ORFfinder (http://www.ncbi.nlm.nih.gov/orffinder).
-
To learn the phylogeny of the FSfaCVs obtained in this study, a multiple sequence alignment was performed with the amino acid sequence of the Rep of the new virus and reference strains, including FSfaCV-as50 (Sikorski et al. 2013b), FSfaCV-JPN1 (Oba et al. 2017), and 30 representative strains of the families Circoviridae, Smacoviridae, Genomoviridae, Bacilladnaviridae, Geminiviridae, and Nanoviridae. Maximum-likelihood trees based on Rep were then constructed with the default setting of the method. To explore the gene variations of the Chinese FSfaCVs, a neighbor-joining tree based on the 585-bp-long gene segments from the 11 positive samples obtained in this study and that of the FSfaCV isolates CHN, as50 (Sikorski et al. 2013b) and JPN1 (Oba et al. 2017) were also constructed. The methods used for constructing the phylogenetic trees were implemented in MEGA 6.06 (Tamura et al. 2013). The tree topologies were evaluated using 1000 bootstrap analyses.