HTML
-
293T and TZM-bl cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco, Grand Island, USA) supplemented with 1% glutamine and 10% fetal bovine serum (Gibco). The 293CD4R5X4 dual tropism cell lines were established by transfection with a CCR5-expressing plasmid (Vigene, Rockville, USA), selected with puromycin, and maintained in DMEM containing 0.7 μg/mL puromycin. All other conditions were as described above. All cell cultures were grown at 37℃ in an atmosphere containing 5% CO2. Dual split protein (DSP) assays were used to determine the fusion capacity of the HIV-1 isolates. Stable cell lines expressing DSP1-7 and DSP8-11 were a kind gift from Prof. Matsuda of the Institute of Biophysics, CAS (Kondo et al., 2010; Ishikawa et al., 2012; Wang et al., 2014).
Construction of ∆V1 deletion mutants (∆V1) for different HIV-1 subtypes was carried out as follows. Wild-type env genes of five HIV-1 subtypes cloned from blood samples of patients with HIV were inserted into pcDNA 3.1D/V5-His-TOPO (Invitrogen, Carlsbad, USA) as a template for mutagenesis, and different V1 mutants were constructed using corresponding primers (Table 1). The subtype B V1 loop was also replaced by Gly-Gly-Gly-Gly-Ser (GGGGS) linkers of different lengths to generate different V1 loop replaced mutants. All mutants were confirmed by sequencing of the entire env gene.
Primers Sequences (5′-3′) Primers Sequences (5′-3′) B∆V1-F AAGGGCGAGATCAAGAACTGCAGCT B'∆V1-F GATATGAAAAACTGCTCTTTCAATCTC B∆V1-R GCACTTCAGGCTCACGCACAGGGG B'∆V1-R AGTGCAATTTAAAGTAACACAGAGTGG B1GS-F CGGCAGCAAGGGCGAGATCAAGAACTGCAGCT 01_AE∆V1-F GAAGTAAGAAACTGTTCTTTTAATGTG B1GS-R CCGCCACCGCACTTCAGGCTCACGCACAGGGG 01_AE∆V1-R GGAACAATTTAAAGTAACACAGAGAGG B2GS-F GGCGGTGGCGGCTCTAAGGGCGAGATCAAGAACTGCAGCT 07_BC∆V1-F GAAATGAAAAATTGCTCTTTCAATACA B2GS-R GCTGCCGCCGCCACCGCACTTCAGGCTCACGCACAGGGG 07_BC∆V1-R ACATTCTAAAGTGACACAGAGTGGGGT B3GS-F GGCGGTGGCGGCTCTCGGCAGCAAGGGCGAGATCAAGAAC 08_BC∆V1-F GGAGTAAAAAATTGCTCTTTCAATGCA B3GS-R GCTGCCGCCGCCACCCCGCCACCGCACTTCAGGCTCACGC 08_BC∆V1-R ACAGTTTAAAGTGACACAGAGTGGGGT B4GS-F GGCGGTGGCGGCTCTGGCGGTGGCGGCTCTAAGGGCGAGA -- -- B4GS-R GCTGCCGCCGCCACCGCTGCCGCCGCCACCGCACTTCAGG -- -- B5GS-F GCGGCAGCGGTGGCGGCGGCAGCGGCGGTGGCGGCTCTGGCGGT -- -- B5GS-R CGCCACCGCACTTCAGGCTCACGCACAGGGGGGTCAGCTTCACG -- -- B6GS-F GGCGGTGGCGGCTCTCGGCAGCAAGGGCGAGATCAAGAAC -- -- B6GS-R GCTGCCGCCGCCACCCCGCCACCGCACTTCAGGCTCACGC -- -- B7GS-F GGCGGTGGCGGCTCTGGCGGTGGCGGCTCTAAGGGCGAGA -- -- B7GS-R GCTGCCGCCGCCACCGCTGCCGCCGCCACCGCACTTCAGG -- -- Table 1. Sequences of primers used in this study
All the primers used in this study are listed in Table 1.
-
HIV-1 stocks encoding the luciferase reporter gene were produced by transfecting the HIV-1 proviral constructs pNL4-3.LucE and pcDNA 3.1 (containing Env) into 293T cells using Lipo2000 reagents (Life Tech., Grand Island, USA). One day after transfection, the cell medium was refreshed, and cells were incubated for another 24 h. The supernatants were then harvested and centrifuged to remove cell debris, followed by passing through a 0.45-μm filter and quantification using an HIV-1 p24 enzyme-linked immunosorbent assay (ELISA; Advanced BioScience Laboratories, Rockville, USA). 293CD4R5X4 cell lines plated 1 day earlier were infected with normalized virions at specific concentrations (1 ng p24/104 cells). DEAE-dextran was added to each infection well at a final concentration of 15 μg/mL. The cells were harvested 24 or 48 h later, washed twice with 1× phosphate-buffered saline (PBS; Gibco), and then used in luciferase reporter assays. Relative infectivity was calculated by dividing the Log10 (RLU of the mutant virus) by the Log10 (RLU of the wild-type virus).
-
Proteins isolated from cells and HIV virions were obtained from different experiments.
For Env expression assays, 293T cells ( > 90% confluence in 6-well culture plates; Corning, USA) were transfected with 2 μg of each Env expression plasmid, incubated at 37℃ for 24 h, washed with PBS, and centrifuged at 800× g for 5 min. Harvested cells were lysed using RIPA lysis buffer, and the lysates were then subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Gp160 and gp120 were detected using sheep anti-gp120 antibodies (Aalto Bio, Iceland). Other antibodies used for western blotting were as follows: anti-GAPDH monoclonal antibodies (MAbs; Beyotime, Guangzhou, China), horseradish peroxidase (HRP)-linked anti-mouse/rabbit secondary antibodies (Cell Signaling Technology, Danvers, USA), and anti-HIV-1 p24 MAbs (Santa Cruz Biotechnology, Santa Cruz, USA).
For Env incorporation into virions, virus (equivalent to 100 ng p24) was precipitated using 5× PEG-it virus precipitation solution (SBI, Shanghai, China), lysed using P0013, and boiled in a defined amount of sample buffer (containing 1/19 volume of β-ME; Bio-Rad, Hercules, USA). The prepared protein samples were used for western blotting, as described above.
-
The infectivity of each pseudovirus containing different Env mutants was determined using luciferase reporter assays. Briefly, cells infected with HIV-1 reporter pseudo-viruses were harvested, washed twice with 1× PBS, and then assayed using the Luciferase Assay System (Promega, Madison, USA) following the manufacturer's instructions. Relative infectivity was then calculated by dividing the Log10 (RLU of the mutant virus) by the Log10 (RLU of the wild-type virus).
-
For fusion assays, cell lines stably expressing DSP were utilized. Stable cell lines expressing DSP8-11 were transfected with expression vectors of interest for Env constructs in triplets. At 48 h post-transfection, 293CD4/DSP1-7 cells, a stable cell line expressing the CD4 molecule and DSP1-7, were cocultured with transfected 293FT/DSP8-11 cells at 37℃ in fresh medium. After about 4-6 h of incubation, membrane fusion was analyzed using fluorescence microscopy (Ishikawa et al., 2012).
The 293CD4X4R5 cell line was also used to assay membrane fusion. Briefly, 293CD4X4R5 cells in 12-or 24-well plates were transfected with different Env expression plasmids. After 24 h of incubation at 37℃, membrane fusion was directly visualized by microscopy.
-
All SIV and HIV env sequences used in this study were downloaded from the LANL HIV sequence database. For comparison of env in the SIV and HIV-1/2 transmission history, env sequences were grouped into four datasets (SIVs, SIVgsn/mon/mus, SIVcpz, and HIV-1) for SIV/HIV-1 and three datasets (SIVsmm, SIVmac, and HIV-2) for SIV/HIV-2, according to known transmission history. Unlike HIV, SIVs have only been shown to have a few variations in sequences; therefore, we used as many sequences as possible based on the HIV Sequence Compendium 2014. Additionally, for HIV-1 and HIV-2 (Figure 1), because many different HIV sequences have been identified to date, we only chose representative standard sequences for each group and subtype according to the HIV Sequence Compendium 2014. For comparison of HIV-1 env sequences between different epidemic periods (Figure 2), we attempted to compare changes in the lengths of the V1V2 region during a 15-20-year evolution period. Thus, each sequence was selected based on its sampling date. Sequences having 15-20 years of sampling (defined here as historical and contemporary sequences) were chosen. Only one sequence for each patient was included, and we adjusted the sampling dates of the historicaland contemporary sequences to ensure that there were sufficient numbers of sequences for each comparison. More information regarding the sequences used in this study is given in Supplementary Tables S1-S3.
Figure 1. Sequence changes in gp120 protein during the SIV and HIV-1/2 transmission history. Amino acid numbers in each region of the gp120 protein were calculated using online tools for SIV/HIV-1 (A) and SIV/HIV-2 (B). Student's t-tests were performed to determine the significance of differences between the two groups; *, P < 0.05; **, P < 0.01.
Figure 2. Changes in the sequence of the V1V2 region after 15-20 years of evolution for different HIV-1 subtypes. Amino acid numbers in the V1 and V2 regions were calculated for subtypes B, C, G, group O, CRF01_AE, and 02_AG, for which there were sufficient numbers of sequences with sampling date spaced apart by 15-20 years. Student's t-tests were performed to determine the significance of differences between the two groups; *, P < 0.05; **, P < 0.01. #His: historical sequences; Con: contemporary sequences.
Variable loop characteristics were determined using the online tools (http://hivtools.publichealth.uga.edu/N-Glyco and http://www.hiv.lanl.gov/content/sequence/VAR_REG_CHAR).
-
Statistical analysis was carried out using GraphPad Prism v6 (La Jolla, CA 92037 USA). The data from the luciferase reporter assays are presented as the means ± standard deviations (SDs) of three independent experiments. For comparisons of two datasets, Student's t-tests were performed, and differences with P values of less than 0.05 were considered significant.
Cells, plasmids, and primers
Virus production and infection
Western blot analysis
Infectivity assay
Membrane fusion assay
Sequence analysis
Statistical analysis
-
SIV/HIV-1 SIV/HIV-2 HIV subtypes (group) Historical Contemporary SIVs (49) SIVsmm (33) B 52 180 SIVgsn/mon/mus (8) SIVmac (27) C 43 422 SIVcpz(28) HIV-2 (30) D 10 15 HIV-1 (62)* G 11 26 01_AE 50 143 02_AG 13 22 O 10 8 Note: *For HIV-1, we choose all the representative sequences from each subtype (group) for the analysis. Historical and contemporary sequences were sequences having 15-20-year sampling time intervals and excluded subtypes that did not have a sufficient number of sequences according to our criteria in the methods. Table S1. Env sequences used in this study
Table S2. Sequences used in the analysis of SIV/HIV-1 transmission history in Figure 1
Table S3. Historical and contemporary HIV-1 sequences used in analysis in Figure 2