HTML
-
To determine the overall differences in piRNA type and expression, we compared the common and unique piRNA sequences among H1-HeLa cells at 12 h, 24 h, and 36 h p.i. The results not only exhibited the typical size distribution of small ncRNAs (around 25–31 nts) (Fig. 1A), but also showed signatures of 5′1U and 10A biases as reported (Miesen et al. 2016a; Leggewie and Schnettler 2018), suggesting that both primary and secondary piRNAs produced when H1-HeLacells were infected with HRV16. Compared with normal control cells, there were 25, 523 of total 22, 151, 664, 36, 229 of total 24, 362, 486 and 25, 009 of total 22, 726, 546 upregulated piRNAs, and 29, 472 of total 22, 151, 664, 28, 906 of total 24, 362, 486 and 29, 541 of total 22, 726, 546 downregulated piRNAs in H1-HeLa cells at 12 h, 24 h and 36 h p.i, respectively (Fig. 1B, Supplementary Table S1). In particular, the infected H1-HeLa cells had 35, 264 upregulated and 25, 855 downregulated piRNAs at 24 h p.i compared with 12 h p.i; 25, 564upregulatedand26, 782downregulatedpiRNAsat36 h p.icomparedwith 12 h p.i; and 25, 268upregulated and 34, 172 downregulated piRNAs at 36 h p.i compared with 24 h p.i.
Figure 1. Overall difference in piRNA expression among HRV16- infected H1-HeLa cells. A The overall nucleotide length distribution of RNA-sequencing results. B Upregulated and downregulated piRNAs in H1-HeLa cells at 12 h, 24 h and 36 h post-HRV16 infection. Black column indicates upregulated piRNAs. Grey column indicates downregulated piRNAs.
-
To screen for piRNAs induced from HRV16 infection, differentially expressed piRNAs at different time points post infection were analyzed. The expression of piRNAs was normalized by the filtering of known and highly-homologous sequences. Normalized piRNAs with a log2 ratio < 1 were removed. Compared with normal control cells, 120, 99 and 165 piRNAs were differentially expressed in H1-HeLa cells at 12 h, 24 h and 36 h p.i, respectively (Supplementary Table S2). In particular, 87 piRNAs were differentially expressed at 24 h p.i compared with 12 h p.i (Supplementary Table S3); 170 piRNAs were differentially expressed at 36 h p.i compared with 12 h p.i (Supplementary Table S3), and 174 piRNAs were differentially expressed at 36 h p.i compared with 24 h p.i (Supplementary Table S3). Our results showed that the expression of 21 piRNAs was concurrently changed among H1-HeLa cells at 12 h, 24 h and 36 h p.i (Fig. 2).
Figure 2. Heatmap of 21 piRNAs concurrently expression among H1- HeLa cells at 12 h, 24 h and 36 h p.i by MultiExperiment Viewer.
Of these 21 piRNAs, seven piRNAs expression was significantly changed at the three infection time points, which have been reported in piRBase. The overall expression of hsa_piR_020391, hsa_piR_000805 and hsa_piR_000651 was downregulated relative to normal cells. Three of these piRNAs were higher than normal cells, which were respectively hsa_piR_017716, hsa_piR_004307 and hsa_piR_001311 (Fig. 3). Interestingly, the expression of has_piR_020326 was upregulated at 12 h p.i but downregulated from 1.49 to -2.38 and -1.18 compared with normal cells (Fig. 3).
Figure 3. The RNA-sequencing result of seven known piRNAs expression levels in HRV16-infected H1-HeLa cells at the 12 h, 24 h and 36 h post infection.
Our results also found that 14 new piRNAs were differently expressed in infected-H1-HeLa cells relative to normal H1- HeLacellsat12 h, 24 hand36 hp.i.ThesenewpiRNAswere named as novel_pir97924, novel_pir78110, novel_pir78107, novel_pir78097, novel_pir78094, novel_pir76584, novel_pir73855, novel_pir70108, novel_pir70106, novel_pir 46604, novel_pir33182, novel_pir15900, novel_pir105705, and novel_pir105700, respectively. After the expression of these piRNA transcripts in infected H1-HeLa cells relative to normal cells was calculated, we found that the overall expression of these new piRNAs was downregulated, except novel_pir78107, novel_pir76584, novel_pir70106, which were slightly upregulated at 24 h p.i (Fig. 4).
-
To confirm the expression of above piRNAs identified by sequencing, we performed stem-loop RT-qPCR to examine the expression of those piRNAs in HRV16-infected H1-HeLa cells. Of these seven piRNAs, hsa_piR_001311, hsa_- piR_004307 and hsa_piR_017716, appeared trend of upregulation at 12 h, 24 h and 36 h p.i (Fig. 5). Expression of hsa_piR_004307 upregulated continuously over 1.5-fold as high as that of normal cells at 12 h, 24 h and 36 h p.i (Fig. 5). Expression of hsa_piR_001311 and hsa_piR_017716 reached over 1.5-fold of normal cells at 24 h and 36 h p.i. However, expression of hsa_piR_020391, hsa_piR_000651, hsa_- piR_000805, and hsa_piR_020326 were lower than normal cells and present a trend of downregulation at 12 h, 24 h and 36 h p.i (Fig. 5). The results showed that changes in piRNAs expression levels were consistent with RNA-seq data. Similarly, we also examined the expression of 14 new piRNAs using stem-loop RT-qPCR in HRV16-infected H1-HeLa cells. Of these novel piRNAs, similar to high-throughput results, the expression of all novel piRNAs was lower than normal cells at 12 h, 24 h and 36 h p.i (Fig. 6). The foldchange of expression level of new piRNAs that compared to normal cells were shown in Table 2.
Figure 5. The expression of seven known piRNAs in HRV16- infected H1-HeLa cells at 12 h, 24 h and 36 h p.i. was validated by RT-qPCR. The infected and normal cells of three repetitive wells were collected at 12 h, 24 h, and 36 h post-infection. Total cellular RNA of each well was isolated with TRIzol Reagent. cDNAs of piRNAs were gotten using stem-loop RT primers. RT-qPCR was performed using specific forward primer of each piRNA and a universal reverse primer. U6 was used as an endogenous control for data normalization. The relative amount of expressed mRNA was calculated by the log2 conversion of 2-△△Ct.
Figure 6. The expression of new piRNAs in HRV16-infected H1-HeLa cells at 12 h, 24 h and 36 h p.i. was validated by RT-qPCR. The infected and normal cells of three repetitive wells were collected at 12 h, 24 h, and 36 h post-infection. Total cellular RNA of each well was isolated with TRIzol Reagent. cDNAs of piRNAs were gotten using stem-loop RT primers. RT-qPCR was performed using specific forward primer of each piRNA and a universal reverse primer. U6 was used as an endogenous control for data normalization. The relative amount of expressed mRNA was also calculated by the log2 conversion of 2-△△Ct.
piRNA id Chomosome Strand Start End Sequence hsa_piR_020391 chr18 - 11, 644, 914 11, 644, 943 UGGUGAGAACUGACAAAUGUGGUAGGUGGU hsa_piR_000651 chr15 - 20, 649, 047 20, 649, 074 ACCAAACCCAUUCUCCCAUCAGUGCUGC hsa_piR_000805 chr15 + 60, 329, 537 60, 329, 567 ACCUAGGACUUGACCAAGGCCACAGCCAGGU chr13 + 130, 067, 407 130, 067, 437 hsa_piR_001311 chr1 - 16, 745, 061 16, 745, 089 AUUGGUGGUUCAGUGGUAGAAUUCUCGCC chr1 + 17, 061, 005 17, 061, 033 chr3 + 15, 524, 505 15, 524, 533 hsa_piR_017716 chr15 + 49, 375, 486 49, 375, 517 UGGAUUUCCAGAAGCUGCUUGAUGAUUCUUCC hsa_piR_004307 chr10 + 126, 301, 128 126, 301, 156 UCCAAAUCGUUCCUUGGGCCCGAGACUCC hsa_piR_020326 chr2 - 94, 796, 255 94, 796, 280 UGGUGAAAUGAACUUCUAGGCAGCAA chr8 + 43, 498, 228 43, 498, 253 chr9 + 42, 454, 099 42, 454, 124 chr9 - 43, 027, 769 43, 027, 794 chr9 - 43, 966, 958 43, 966, 983 chr9 - 66, 114, 219 66, 114, 244 chr9 + 68, 761, 351 68, 761, 376 Table 1. Characteristics of seven known piRNAs in the H1-HeLa cells.
piRNA id Chromosome Repeat family Strand - Start End Sequence novel_pir97924 chr8 LINE/L1 - 136, 785, 683 136, 786, 238 GGGGGGCCCAAGTCCTTCTG novel_pir78110 chr3 DNA/hAT-Charlie - 61, 684, 855 61, 685, 144 CCACCCTGAACGCGCCCGA novel_pir78107 chr3 DNA/hAT-Charlie - 61, 684, 855 61, 685, 144 ACCACCCTGAACGCGCCCGA novel_pir78097 chr3 DNA/hAT-Charlie - 61, 684, 855 61, 685, 144 TACCACCCTGAACGCGCCCGA novel_pir78094 chr3 DNA/hAT-Charlie - 61, 684, 855 61, 685, 144 TACCACCCTGAACGCGCCCG novel_pir76584 chr3 DNA/hAT-Charlie - 31, 021, 593 31, 021, 781 GTTGGGACAAAAAAAAAA novel_pir73855 chr3 LTR/ERVK - 15, 779, 666 15, 780, 942 TTCTGGGCTGTAGTGCGCTA novel_pir70108 chr2 LTR/ERVL-MaLR - 12, 439, 669 12, 440, 139 GGTTGGGAAAAAAAAAAAA novel_pir70106 chr2 LTR/ERVL-MaLR - 12, 439, 669 12, 440, 139 GGTTGGGAAAAAAAAAAAAA novel_pir46604 chr18 LTR/ERV1 + 68, 878, 785 68, 880, 277 GGGCGGCGGGGCGGGGCGG novel_pir33182 chr14 LTR/ERV1 102, 706, 661 102, 707, 085 TCCCGGGTTTCGGCACCAAA novel_pir15900 chr11 DNA/hAT-Tip100 + 62, 126, 034 62, 126, 618 TGGTTAGCACTCTGGACT novel_pir105705 chrX LINE/L1 + 121, 106, 366 121, 108, 397 ACGTAGCAGAGCAGCTCCCTCGC novel_pir105700 chrX LINE/L1 + 121, 106, 366 121, 108, 397 TACGTAGCAGAGCAGCTCCCTCGC Table 2. Characteristics of 14 novel piRNAs in the H1-HeLa cells.
-
piRNA prediction was performed using Piano (Wang et al. 2014), and known piRNAs were verified by the Bowtie software. Secondary structure/folding of new piRNA sequences were predicted by UNAFold. The chromosome (chr) location of seven piRNAs was analyzed through piRBase. We found that hsa_piR_004307 and hsa_piR_020391 were located on chr 10 and 18, respectively. hsa_piR_001311 was located on chr 1 and 3, hsa_piR_020326 was located on chr 2, 8 and 9. Interesting, hsa_piR_020326recognized6sequences ofchr 9. hsa_piR_001311 recognized two sequences of chr 1. hsa_- piR_017716, hsa_piR_000805 and hsa_piR_000651 are located onchr 15. hsa_piR_000805was alsolocated onchr 13 (Table 1).
piRNA prediction found that novel_pir97924 is located on chr 8 and recognizes Long interspersed nuclear elements 1 (LINE-1). The novel_pir78110, novel_pir78107, novel_pir78097, novel_pir78094 and novel_pir76584, which are associated with the DNA/ hobo of Drosophila, Ac of maize and Tam3 of snapdragon (hAT)-Charlie transposon, are located on chromosome 3. The novel_pir73855, related to the long terminal repeat (LTR)/ Endogenous Retrovirus-K (ERVK) repetitive element, is located on chr 3. Both novel_pir70108 and novel_pir70106, which are associated with the LTR/ERVL-MaLR repetitive element, are located on chr 2. Novel_pir46604, which is related to the LTR/ERV1 repetitive element, are located on chr 18. The novel_pir33182 is located on chr 14 and is associated with the LTR/ERV1 repetitive element. The novel_pir15900 is located on chr 11 and is associated with the DNA/hAT-Tip100 repetitive element. Both novel_pir105705 and novel_pir105700 are located on the X chromosome and are associated with the LINE/L1 repetitive element (Table 2). Our results indicated that HRV16 infection-induced change of many new piRNA to recognize chromosomes.