HTML
-
A total of 198 gilts and multiparous sows distributed in 11 farms from three major swine-producing areas in Colombia (Antioquia, Valle del Cauca and Cundinamarca) were included in the present study. Blood samples were obtained via venipuncture of the jugular vein using red top Vacutainer TM tubes. Serum samples were identified and stored at -20℃ until analysis.
-
Two hundred and forty-two nasal swabs, 8 bronchial lavage (BL) and 25 lung tissue samples of animals displaying symptoms compatible with SIV (Easterday B C, et al., 1999) were collected from the 11 farms. Samples were collected in Brain-Heart Infusion medium (BHI) medium (BD®) supplemented with 2% antibiotic and anti-mycotic solution (Sigma®), filtered through a 0.22 μm filter, and stored at -70℃ until processing for SIV isolation, either in chicken embryo eggs or the Madin-Darby Canine Kidney (MDCK) cell line.
Briefly, 9 day-old SPF embryonated chicken eggs were inoculated via the allantoic cavity with 200 μL filtered sample, incubated at 37℃ for 72 h, and monitored daily. Allantoic fluid was collected and evaluated for hemagglutination activity following standard procedures (WHO, 2005). Twenty four-well plates were seeded with 8×105 cells/well of MDCK and grown in Dulbecco's Modified Eagle Medium (DMEM)(Gibco®) supplemented with 5% fetal bovine serum (FBS, Gibco®), 1% antibiotic (Sigma®) and 1% L-glutamine (Sigma®). Complete growth medium was removed from confluent monolayers and washed three times with PBS supplemented with 2 μg/mL TPCK Trypsin (Sigma®). Each well was infected with 200 μL of the original filtered sample and incubated for 1 h at 37℃, 5% CO2, followed by the addition of 2 mL/well complete DMEM. Cells were incubated at 37℃, 5% CO2, for 3-6 days and monitored daily for cytopathic effect (CPE). Following the incubation period, cell culture supernatant (CS) and allantoic fluid (AF) were collected and tested with the hemagglutination assay (HA) using chicken erythrocytes according to the standard Office International des Epizooties (OIE) protocol (Swine influenza, 2005).
-
All HA-positive samples from egg inoculation or cell culture isolation were further analyzed for efficient subtyping of virus. Viral RNA was extracted using a commercial RNA extraction kit (QIAmp viral RNA®, Qiagen, CA, USA) following the manufacturer's protocol. Amplification of HA and NA gene segments was performed with a duplex reverse transcriptionpolymerase chain reaction (RT-PCR) assay targeting the respective genes of H1N1 swine influenza virus (Choi Y, et al., 2002). Initial reverse transcription was performed with M-MVL reverse transcriptase (Invitrogen) using 4 μL viral RNA as template and the uni-12 primer (Invitrogen, Maryland, USA) to generate cDNA. The conditions for reverse transcription (RT) were as follows: 70℃ for 5 min, 94℃ for 5 min, 42℃ for 30 min, and a final step of 4℃. Amplification of 1006 bp HA (primers H1F and H1R) and 754 bp NA (primers N1F and N1R) genes of SIV was performed (Table 1) under the following reaction conditions: 94℃ for 5 min, 35 cycles of 94℃ for 1 min, 53.5℃ for 1 min, 72℃ for 1 min, followed by 72℃ for 15 min, and a final step of 4℃ to terminate amplification.
Primers bp Tm %GC Product H1 1006 pb H1F 5´GGTAGATGGATGGTACGGTTA3′ 21 53.4℃ 47.6 H1R 5´GGTCCACCAACT TGAGAAATG3′ 21 53.9℃ 47.6 N1 754 pb N1F 5´TAAATGACAAACATTCCAATGG3′ 22 49.5℃ 31.8 N1R 5´AACTATCACAGACAATAATA3′ 20 43.0℃ 25 Table 1. Primers and PCR conditions for diagnosis of SIV-H1N1
PCR products were run on an agarose gel, and isolated and gel-purified using the QIAquick Gel Extraction Kit (Qiagen®). Gel-purified products were sequenced by Macrogen®, USA, using Big-Dye® Terminator Cycle Sequencing. DNA sequences were combined and edited using the Lasergene sequencing analysis software package (DNASTAR®, Madison, Wisconsin). Multiple sequence alignments were made using Clustal W to identify related reference influenza genes. Sequence comparisons and phylogenetic relationships through a bootstrap trial of 1000 were determined with the Mega 5.1 program using the Clustal W alignment algorithm, and evolutionary history inferred using the Neighbor-Joining method (Saitou N, et al., 1987) for tree construction. Gene sequences of Colombian strains were compared with those of swine, avian and human influenza viruses, which were retrieved from the NCBI Influenza Virus Resource.
-
Serum samples were subjected to the hemagglutination inhibition test to identify antibodies against SIV using strain A/Puerto Rico 8/34 (H1N1) as antigen, according to the WHO protocol (2005).
-
PRDC was diagnosed based on detection of antibodies against PRRSV, Myh, APP and PCV2 in serum. Specific antibodies were measured with ELISA kits (Table 2).
Agent ELISA Kit PRRSV IDEXX PRRSV X3 Ab Test Mycoplasma hyopneumoniae IDEXX M. hyo. Ab Test Actinobacillus pleuroneumoniae ID VET -ID Screen® APP Screening (1-2-4-7-9-11) Circovirus Porcino tipo 2 Ingezim PCV, INGENASA Table 2. ELISA kits used to determine the presence of PRDC
-
Data were analyzed using the Statistix 8.0 program. The chi-square test was initially performed to determine the probability of presentation of respiratory disease complex with and without the presence of SIV, and logistic regression analysis subsequently utilized to determine the risk factors that increase the presentation of disease when PRDC farms and animals are positive or negative for SIV. Data were considered significant at p < 0.05, and graphs plotted using GraphPad software.
Animals
Virus Isolation
Viral RNA Extraction and RT-PCR
Hemagglutination inhibition test (HI)
Diagnosis of porcine respiratory disease complex
Statistical analysis
-
Among the 11 farms surveyed, 7 were positive for swine flu pandemic virus, either from embryo chicken egg or MDCK cell culture isolates (Table 3). Positive SIV isolates were obtained from farms located in Antioquia and Valle regions including both weaned and fattening pigs. The SIV-H1N1p strain was not found in the Cundinamarca region.
Virus Region MDCK Cells Embryo chicken Eggs A/SW/COL0102/2009/H1N1 OCCIDENTAL + - A/SW/COL0201/2009/H1N1 ANTIOQUIA - + A/SW/COL0301/2009/H1N1 ANTIOQUIA - + A/SW/COL0502/2009/H1N1 OCCIDENTAL + - A/SW/COL0602/2009/H1N1 OCCIDENTAL + - A/SW/COL0701/2009/H1N1 ANTIOQUIA + + A/SW/COL1002/2009/H1N1 OCCIDENTAL + + Table 3. Swine influenza virus isolated by region
Sequencing of the gene encoding HA resulted in grouping of strains into viruses that were circulating during the human outbreak of 2009, classified as pandemic H1N1-2009. In Figure 1, the upper part of the tree represents pandemic viruses isolated during 2009 (including California 04, 2009). These viruses showed 98.53% identity with A/swine/Colombia/0102/2009 (pH1N1) and A/swine/Colombia/1101/2009 (pH1N1) isolated from pigs in Colombia during 2009. The tree pH1N1 Colombian viruses displayed ~99% identity. The three remaining viruses showed sequence changes in HA, prompting the theory that they represent predecessors of the virus isolated in 2010 from farms within the country (Ramírez-Nieto G, et al., 2012).
Figure 1. Phylogenetic relationships of SIV-H1N1p isolated from swine-producing farms in Colombia.hese viruses show 98.53% identity with A/swine/Colombia/0102/2009 (pH1N1), A/swine/Colombia/1101/2009 (pH1N1) and A/swine/Colombia/1403/2010 (pH1N1) isolated from pigs in Colombia during 2009 and 2010. pH1N1 Colombian viruses show ~99% identity.
-
The hemagglutination inhibition test revealed positivity to SIV-H1N1p in 36.3% gilts, 33.3% sows with 1-2 births and 30.3% sows with multiparous ( > 3) births. The data suggest a trend in reactivity to SIV-H1N1p, as the antibody response appears to decrease through time.
-
PRDC presentation was lower in SIV-H1N1p-negative than SIV-H1N1p-positive farms (Table 4). The odds ratio value and p value revealed significant differences (p < 0.05) in PRDC risk presentation in gilts and multiparous sows of SIV-H1H1p-positive farms (Figure 2). Analysis was completed using logistic regression to determine the likelihood of increase in PRDC disease presentation in SIV-H1N1p-positive farms.
PRDC Negative SIV-H1N1p farms Positive SIV-H1N1p farms App 64.5% 81.1% Myh 56.9% 79.4% PCV2 87.5% 96.0% PRRSVV 15.3% 1.6% Table 4. PRDC percentage in SIV-H1N1p-positive and-negative farms
According to our results, SIV-H1N1p-positive farms had 3.19, 1.75 and 5.14 times greater risk of introduction of APP, Myh and PCV2, respectively, compared with SIV-H1N1p-negative farms. In contrast, for PRRSV, reduced risk of disease presentation (OR, 0.05) was observed in farms positive for SIV-H1N1p.
The presence of SIV-H1N1p in positive farms increases the risk of introduction of PRCD especially PCV2, APP and Myh. When analyzed byage group, the gilts are more susceptible to PCV2, Myh and APP, respectively, while multiparous sows are more susceptible to PCV2, APP and Myh.
-
Logistic regression analysis was performed to determine the risk of PRDC presentation in farms positive and negative for SIV-H1N1p. The odds ratio andpvalue revealed significant differences (p < 0.05) in risk PRDC presentation per individual. In animals positive for SIVH1N1p, major risk of Mycoplasma hyopneumoniae, PCV2 and APP presentation was 2.42, 2.08 and 1.98 times that of SIV-negative animals, respectively. In contrast, for PRRSV, the risk of presentation of disease (OR, 0.74) was decreased in animals positive for SIV-H1N1p.